Description :
From Genome Similarity Track
Location :
Scaffold_292:1- 2903
Transcript NameFunction/comments
Physo_144864hypothetical protein

Sequence
2902 bases(100 bases per row)
TTTGGCAGAGTGTTTACACTTCTTGGGAGTCAACTTTCGATGTCGACTGCGGACCATCCGCAGACGGACGGGCAGACCGAGCGCGTGAACCGCGTGCTCG
TAGACGTGCTTAAGAGCTACGCTCACTCGTTCCAACACTGGAGCGAGTGTCTGCCGATGCCGGAGTTTGCCATCAACAAATCGGTGCATGCCTCGACCGG
GCATACACCGTTCTACGTGAATGCCATCAGGCACCCACGCCTCCCGAGTCTACTCGGGATGGTGGCTCCTTCCTTAAGTGGGGGAGGATCTACGACTGCA
ACACAGCAGCCGCAGAATGCCGCTGACACTTGCACAGTGTCAGCCGCGACTACGCGCAAGAAGAACAAGAAGCACGCGTCTGTGCAGGGCACAGACACCG
TGAAGACGAACGCAGAGGCCGGGTTTACTGCTAGAAACGAGCTGAACGAGTTCAGCTCGGACGCAATTAACTTCGTGCAGCGCAGACAAGCCGTCATTCG
GCTTGTCCAAGACGCTGTCGCAGCTTCTGTCGACCGACAGAAGCTGAACGCAGACAATGTTGGTAGGGGCAACACTAATGAATTCAAGAAGGGTTCATTG
GTTTTGTTAGCAACTCAAAACCTGCCTAAACATGCAGTTTCCGACTTCGGAGCGAGCTTGCTCGCTCCGCGCTTCTTCCCGTTCACGGTGTTGGCACGGG
ATGGCAACGCCTACACACTAGATATTCCATCTAGCATGCGCCTCCATCCGACCTTTTACATCGGGCGGCTGAAGTCATACCTGCAGCACGAGCCACCTAG
CTCGGCTGGCCCCGAAGCGGAAGCCCCAGCGGGAGCGAACCTCTGCTCCAGCGCGTGAACGCGCTGGGCCAAGCGTGCGACGCGACCTCCCACGTCGACA
GAGATGTTCGACGCGGTCTGCGAGGCCTGAGCGACTTGAGCCCTCAGGATCGCCACCTCCTGCTTCAGAGCGGCGAACTCCCGGCTCTGATGCTGTTCCA
CAGCAGCGACCCGCTCCTCGAGCGTCGGGCCAAGGTCAACCCCAGGTTGACCATACCCGGGGCGTGTTCCCACCACCGCCGCCTCCGATCCGCGACGCCC
GCGGCTCAACACGCTGGATTGTTGAGCGTATTGTGAACCATAGTATCCCGAAAACGAACCGGCAGTCGGTTCGTTATCGTATTCGTTGGAGAGGGTTTCC
GCCCCACCAAGATATATGGGAGCCACGGGACGTCCTGCTGCAGGACGTGCCGGAAATGGTGAGGGCGTACGAAGCTCACCACGCACTGCCGACGCGAAGG
TAGTGCGAGCGCTGTGGTCACCTACAGCGCCCGAGGTCCCACGATCGTCGCGTTCCTCGCGTGCCAAGAACTTGGCACGAAGATCCTTGGGACTCTCAGG
TACACGAATCGTCGTGAACCCGTTTAGGTCGCGGTCGCTCAAGCGCGCCGCACCCGGAAGCCACAACGTGCACTGTTGGCCTTCGGGCGCAGCGCATGGA
ATACCAGCGTCCACAGAGGATCTGTGGAGCTGCTCCAGCCTCCCGCGCGTCGAGAATGTCTCGAAGCGTTCACGGGCACGCTTAACCCGCTCGTGGTAAG
CAGCCGGTTTCTGGTTGAAGTTCTCAACAAAAGCATTCCAACTTTGACAAAGTGCCTGCCACTCAGGTACTTTGCTGCGAGAAGAGGTCTTCTTGCTGGA
GAAGTACCGGAGCTCGTGGAAGAGCCCGATGTAGTAGTCGCGCCTTTGATTCGTTAACGGATCAAAGTGCTGCTCCTCCGCAACAGCATCGTCGTGGATA
CCGCTGCATACGTACAGCGGGATTTCGTTTGGAGGCACAGTGTTGCCCACACGGTCTGCGATCTCTGACGCAGACGGCATCCACGGATCACGCGCTGCCT
GAGCAGCGCGCGGAGAGCTTGAAGGCGCTACCTCACGCGGGGAGCTTAAAGCCCCAGCAGCAGAGAGCGGAGTGTCGCTCTCGCCGCGCGAACGCTTCGA
GCTCGAAGCGTCCGAGTCGTCTCCTTCACGAGGGCGTCTCGACCCGGCATGCGGGTCGAGACTATCGCTGTCGATAGACTCCTTGCGCTTGCTAGAAGAG
GCCTCGCCCTCTTCCATCTCCACGTCGTCGTCTTCGTAGTCAACGGCGTTGTTGACTACAGAAGAACCTTCGAGGACAATCTCTGGTTGAGTTGTCCCCG
CCGCAGCCTTGGAAGCAAGAGCGTCACGCTTTGCTTTGAGACGCTCGCGGTACTCGGAGATAGAGAGAGTCTCTATCCCGGCGGAGGACTTCCCCTCTGC
TGTAGCGTCGGTCTTCTTCTGAGGCGAGCTCATTGCGGAATGAGCTCGAGTTTCTTTCTCCCAACGTGAAGAATTGACGAATGGTCAATTTCCTGATTGA
CGTGCGGTGACTCGGCGCGTCTAACCTTGAGGGGGGATGGTGTAACAGGGTTACACGCACAAGTGGCTACAGTCACTTGTTACTCTAACATATGCGATGT
CTGTTAGAGGTTTAAACACTTCCTCGACCTTGGTGTAAGGTACACCAATGGCTACATACATTTTCGACCACCACGACGGGTGGTCCATACACATTTAGGA
TTCCTATTGGCTGAAAGCAGCATCTTTTAGCCAATGAGTGAATTGCATGTTAGCAGAATCCTGCCATCCAGCCGTTGGCAGATTCCTAGCTTAGAATATT
ACATTTAGAGGAAGTCAGAAACATAAAACAAAATAGGAGTTCTCATCTTTTACCAAAACCCGCTACTTGGAGTCTTTATCTTGTTTAAAGTATACTCGTG
GATCTCGAGTATACTTAACTCAAGTAAAAGAAACCTACGCTTCCTCATACACGTGCGCATACGTGTAAGCCGTAGCAGTGAACCAAGGTAGGCCCACTAC
AC