Description :
From Genome Similarity Track
Location :
Scaffold_2803:1- 2860
Transcript NameFunction/comments
Phyta_totarag14848reverse transcriptase

Sequence
2858 bases(100 bases per row)
CGTGCGCATACGCGgccttcacgtcgtcgatcagagacgacgacggagaacTCGATCGAGCGACACAATGGCATTGGAGTCGGCTGTCTTGACAACGTAG
TCAGGTCGACACGATAacgcgtcggccaccacgTTCGATCGGCCGGGTTTGTGTTCGACCCGTAAGTTGTATTCCACAAAGAGTGACAACCATCTTGCCA
TTCTCTGAGAGATGTGCGGCGACTTGATCGCCGTACGCAGCGATATATGGTTGGTATAGACCACGAACGGTCTGTTTTCAAGTAGATACACTCGAAACTT
TGCGAGTGCATACTTCATGGCAAGGAGTTCCTTGTCACGCACCGGATAGTTGCGCTCAGCTGGCTTCAGCTGACGCGACCGGTAAAGACCACACGATCAC
GACCCTCGtgatcgagctgcatcaacgcgCATCCGATTGCAAAGTCGGACGCGTCACACACGACGTGGAATGGACGATCTTGGTCGGCCACTGNCAAGCA
CGGGTATCTCGCTCGCCCCGAAGATACACTTCTTCAGGTTCGCATAGAGCTTATGATTACGCATTAGCCCAAGCATCTTACGGAGATGCACTTTGTGCAT
CTCGACAGCCGTCTTTCCGTCCACAGCCCGGCTGTGAATGAACTCGTCGTCAATGTAACTCGGTGCGAAGTCGCGCACCGAGCGTAACAAGTGCGTGACG
CACCTGCTGAACGTTGCAGTGGCGTTCTTTAACCCCTGCGGCATGACGAGCCATTCCCAAAGCATACCGCTTGGGGTGCTTACCGCTGTCAGAGGGATGT
CACTCTCACGTATCAAGATCGGATAGAATCCGTCTCTCAGATCAAGAGCACTATAGATAGTACTCTTGGCCATCGAATCGATGATCACATATTTTCGCGG
TATCGTCGCACcgttcagcttgttgtaCGCATGAACGATGCGCCAGCCGTCATCTTGACACAGAACGTCGGCGCACTGTGCGGGGACTTCGATTCCCGCA
CTTGGCATGCTTTGCGACGACTttcgaagaagtcgtcgatcgCCTTGCCTTGTTctcgcggcagtggccactgccgcgtgACACAGTACTTCGTGCCCGG
CACGAGATNCTTCAACTCTTCCGCCTCACACTTCAACCTTTCCATGTCTGAAAGGATGCagatctgctcgatgcgtCCACCGTGCAGGTCGCGCGCaaag
cgcttccagctcatgaCTGGAAGCGACGTCAACTCCGACGCACTCGTTGGGGGACTATCAAGAGTTATGCTCCTGTACTGAAGCCCAGTACATGTCTGCG
TCAAGACACTCAATCTCTCGACGCTCGACGTCGGAACTGATGTTTGCCCGGCAGACATCTTGCTTAGCGTCTCGGTCCCGGACCGAGACTCGTGCAGCTT
TTTCAGCTTCCACTGTCGTTCCTTCTTGCGGAGCCCGGCTCCGCATGTTCTTCGTCCACGCCCGCTTGACCGGGCAGTGGACGGGTTCGCGTTATCATCG
CCGGCGGATTGTATCCGCGGGCGCGCTTCTGTTTCGTGCAGCCCGGCTACACGAGAGCTCCCAAGCTGTTCTAGTGCTGGACGTTTGCAACCGTCTGTAC
TGCTCGCAGCGTCAGCTCCCGACGCTGACGCGTCTTCGTTACCTCGACGCCGTTCGGCGGAGTTTTCTGTCGAATCTGATCCAATCAGATTCTCTGTGTC
GTTTCCCAGAATCGACACACATTCACTTCCAACGACTTCGGAAGTCGTTGGAGCTTTCTTTATTCACGCCCTGCGCGTCGAGACAGCAGCGTTAACCGCT
GTCTCTACTGGAATGCCGCATGCACCTTGCGGTGCACGTGTCGCGCTGTCGCGACCGAAGGGTACGATTGtacgcttcttccagttcatTTTCGGGtcat
gcccagcaccaagtcgaacttgtcgtctaaGTCTAAGACGGTAAAATCCTCAATAAATCTCTTTTGTTGATATGAGAAGCGTATGGCACGCTTCTCGTTT
TTCACGACGGCACCTGTTGCCAGTCGTACTTTCAACATGCTTCGAGGGGtttgcacctcctcgaagtcaaCGCTTGGCAGAGTCTGCAGTCGAGCAAAGT
TGTTCGACGCACCGGAGTCTACTAAAGCTCGAAGAGAGTTCGCTCTCTTCGAAgacacgtccaggatgacaaGGTTGGGCTTGTCATCTCGCTTCTTGCA
GTGAGATTGCCTCTCACTGGGGGCCGCAGCCTTCATTGACGCGTGTCCGATGTCGACACGCATGACTGCTTTACCAGTAGGGCGTCCCGCGCCTACTGGT
TCCgcgcgtttttttttaatggATCGTAGCGATGccctgcatcgccacgttgACCTCTCTGCCCGTGCACAAGTGCTGTGCACTCACGCGCAAAGTGACC
GATGCGCCCGCAACGGATGCATCGTACGTCAGCTccgcgacgtggtgggtTGCTCCCAGCCGTTGCGTTCGAGAGGTCCATTGGTTCTGGACCTCCCGTC
CTTATCATCGGACGTGTTATCCTTGGCACGCTCACATGCAGTTTAGCCTGCTTCAGGCTAAACTCTTCTTGCATTGCGAATGTgatcgcagcttcgagag
tACTCAGGTACTCTCGGAAGAGATAGGTCTTCACAGGCCCATCCTTCAGACccttcatgaacgtgacgaccTTAGTCGCCTCGTCTATCGGGTTAGTCAC
GATGTTCGAGACCAAGTACCGTGCCCTCTGGGCGTAAGCATGGGCATCATACTTACCCTGCTGTAGATCGAGGAACTCTGCCCTCGATCGGAATTCGTTT
TACGGGGCTCAAACGCTTGTCTGAACTCCTCCTTAAAGGTCTCGTACGTGCTGAAGCA