Description :
From Genome Similarity Track
Location :
Scaffold_176:1- 2813
Transcript NameFunction/comments
Physo_144278reverse transcriptase

Sequence
2812 bases(100 bases per row)
AGTGCATCTTCGGGGCGAGCGAGATACCTGTCTCGTTGGGAAGAACGGTGTCCGCCCTGACCCTGAGAAGGTCAGAGTGATCAATGAGTGGCCGACGCCG
TCGAATGTCAATGAACTGCGGCAGTTCCTTGGCTTGGCCACGTACTTGTGCAAGTACGTGAAGGACTACGCGGGCATGATACGCCCGCTGTCACAGCTCC
TGAAAAAGGACGCCGAGTGGAATTGGGCTGCTGAGTGTCAGCAGGCCTTCGATGCAGTCAAGCAGGGCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGA
CCAAGATCGCCCATTCCACGTTGTGTGCGATGCATCCGATTTCGCAATCGGATGTGCGTTGATGCAGCACGATCACGAGGGTCGTGATCGTGTGGTCTAC
TACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAACTACCCGGTACATGACAAGGAACGCCTTGCCATGAAGTACGCACTCGCGAAGTTCCGAGTGTATC
TACTCGGAAGCAAACCGTTCGTGGTCTATACGGACCACGCGTCGCTGCGGACGGCTGTGAAGTCGCCGCACATCTCGCAACGGATGGCGAGATGGCTCTC
ATTCTTCGCAGAGTATAACTTCCGGGTTGAGTACAAACCCGGAAGACTCAATGTGGTGGCCGACGCGCTCTCACGCCGACCTGACTACGCCACGACTGAT
GCCGACGTCAATGCCATTGACGCCATGCGATCGAGCACCCCAACGTCGTCACTGTTGGACGACGTGAAGGTCGCGTACGCGCACGACGCGGACGCGAAGC
TCTTGCTGGCCTATGGCTCCGCGCCTTCTGACAAAGCTCGTCAGAAGCTGCCGAAGCATCTTCGTGCTCGTGCACACCGTTATCGGGTGCACGACGGGTT
ATTACTCTACAGTGCAGTCGACGACAACGCGGACCGCGTTGTCGTGCCCTATGACCATGACCTGCGACACAGGATCATGTATGAGTATCACGATGCGCCG
ACTGCGGGGCATCCGGGTCGTGAGAAGACATACCTTCTTCTCACGCGTGACTTCTACTGGGCCCACCAGTACAAATGGGTGCGCAAGTACGTCCGTGCTT
GCGAAGTTTGTCAACGTGTGAAGCCTGCGCCGTTCGCGCAGGCTCCCTTGCAGTCACTCCCGACTCCGTCGGAGTGTTGGCAGTCCATGTCTTTGGACTT
CGTATTCGGTCTTCCCCCGGACAGCCAGGGGAACACAGGCGTTGTGTCTTTGTTGGCCGCTTCAGCAAGATGTACCATCTTGCTGCTGTACCCGCTGAAG
TGACTGCGAAACAGACTGCACGTCTGTTCGTCGACATGGTGTTCAAACACCATGGCATCCCGATCGACATTGTGTCGGATCGGAACCCGCGCTTCACTGC
ACACCTTTGGCAAGAAGTATTTACACTTCTTGGGAGTCAACTCTCGATGTCGACTGCGGACCATCCTCAGACGGACGGGCAGACCGAGCGCGTGAATCGC
GTGCTCGTTGACGTGCTAAAGAGCTACGCTCACTCGTTCCAACACTGGAGCGAGTGCCTGCCGATGGCAGAGTTCGCCATCAACAACTCGGTGCATGCCT
CGACCGGGCATACACCGTTCTACGTGAATGCCATGAGGCACCCACGCCTCCCGAGCCTACTCGGGATGGTGACTCCTTCCTTAAGTGGGGGAGGATCTCC
GACTGCAACGCAGCAGCCGCAGAATGCCGCTGACACTTGCACAGTGTCAGCCGCAACGACACGAAGTAAAGCCGAGAACCGCGCGTCTGTGCAGGGCACA
GACGCCGACAAGCGCACGAAGAACGTGTCTGTGCGGGGCACAGACACTGACAAGAACAAGCAGAAGAAGAGCGTGTCTGTGCAGGGCACATACACCACGA
AGACCAACGCAGAGGCAGGGCCTACTGCTGAAAGCGAGCTGAACGAGTTCAGTTCGGACGCAATTCACTTCGTACAGCGCAGACAAGCCGTCATTCGGTT
TGTCCAAGACGCTATTGCAGCTTCTGTCGACCGACAGAAGCTGAACGCAGACAATGTTGGCAGGGGCAACACTAATGAATTCGAGAAGGGTTCATTAGTC
TTGTTAGCTACTCAAAACTTGCCTAAACATGTCGTTTCCGACTTCGGGGCGAGCAAGCTCGCTCCGCGCTTCATCGGGCCGTTCACTGTGCTGGCACGGC
ACGGCAACGCCTACACACTGGACATACCGTATAGTATGTGTCTCCATCCGACGTTCTACGTCGGAAGGCTGAAGCCATACCTGCAGCTCGAGCTACCTAG
CTCGGCTGAACCGAATCAGAAGAATCGGCGGACGCCGTCATCCTCTCCAGCGCGACTTCGCGCTGGAGCAGCGGGTCGAGCTAATGGTCCAGCTCGGCCG
AAACGATCGATGCGGTCTGGGAGGCCGCCGCAAACTGCGAATACTTCAGAGCGCCGAACGCAGCGCTCTGGAACTACTCCACGACCGGGACTTGGTCGTG
GGGAGACGCGAGATCAGAGTCAACACCAAGTTGACCACACACGGGGTGTGTTTCCGCCACCGCCGCCGCCAATTCGCGATGCACACGGCTCAACTCGATG
AATTGTTGATCGGATTGTTGATCACAGTATCCCGAGAACGAACAGGCAACCAGTTTGTTTTCGTATTCGTTGGAGAGGATTTCCTCCCAACCAAGATACA
TAGGAGCCACGGAACGTCTTGCTCCAAGACGTTCCAGACTTGGTGAGGGTATACGAAGCCCACCACGCGCTACATACTGGAACGTAATGCGAGCGCTGCT
GTTAACAGCACT