Description :
From Genome Similarity Track
Location :
Scaffold_2457:1- 2809
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_2457-snap-gene-0.0Protein kinase
Pytul_var.sporangiiferummaker-pug3_contig_2457-snap-gene-0.1Gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_2457-snap-gene-0.2Ankyrin 2,3/unc44

Sequence
2807 bases(100 bases per row)
GATCAGGTTCCACTGCTTATCAGTGATCCGCCGTCTATACAACTGGAATGCGTCCCTTTTTCAACTGGCACTTGACTCCAGCACTTAACATGTTGCTACC
CCACGGAATGGCCTTCGTCACTGCTTCTAAGATGCACACAGCATACGAATAGACGTCGGACACAAACGTGGGCCGTCCACCACCCAGATACTCGGGCGAT
TTCCAGTGCACAGCCCCCCATATGTTTCTTGCCGACCATGATTTCAGTGTCGTTGAGGATCGCGCTCAAGCAGCTTGAGTCAAGCCAAAGTCGATGAGGT
TTGCCTCCTTGTCAATACCGACTATCCCGTTGTCGCACTTGAGGTTGTTGGCACGACGCTTATTCCATGCATGCACGCGAGCCCCAGCGCGACTTCGTAT
ACACAAAGTATAGCGCTGGTCGGTGTGACAGGAGCCGTATATAATTCCATAATGTGGGGGTGCTTCTTCAGCCGATACCATGTTCGTACTTTGTGAAGGA
ACAACTCGTTCTGAGTTGCATCGCGCGTGTTCATCCCCCATAAACTTGATCACGATCGGCGTATCCAACCAGACTCCTTGGAACACTTTTTTCCAAACGC
TCCTTGCCTTCTCACGATCCTCCTTAAGGTGCAAGCTCGCTCTCTTAGTAAATCGATTTCTTGGACACTCCAGTACGCAAGTACTTCTTCAGGTCGTGGG
GTGTAGCATAGAACCTGCCAATAACAATGTCCGTCGTTTGCTTTTCTTGAGACACGATCTGTTGGAAAATGAAGTCTAATGCTAGGTACGCATCAGTGAT
GAGCCACCCGGACTCTGGCAACCGAAGGCAGCGTTCCCGAATGCGTTGTAGCTTGGCTGGGAGAGTGAGCAGTCCGAGATCTGGGAACTGTAGTGTCTTG
ATGCGTCCAGACTAAATAAGCTTGCATCAAACAAATCAATACAAGAAAGAGGTTTACATGGCAGACGAAAGAGACTTGAGTTGTCCAGAAAATAGTTCGA
GTGATGCGTTGATGAAGATATTGAATGCCAAGTGCGACCTCGGACAGGTACTTCCTGCAGACTTGTTGGTTATGTTCATGTGGTAGCACAACGAGTAGTC
GTGTTCCATACTCATGCACGAAGAAGGACACAGGCTCGATGTGGCATACACCGAAGAGCTTCTGCACGTTTGGGTGGCTAAATGGATACCATCGCGCTGG
CTGCAGCCACGCTGAAAGTCGTCCATTTCCAATTCAGACGCACCGACTATCACTTTAGTCTTTAGCCATTTCTCTTTCATACTGTATGGTATCGGCACCA
CCCGTGGAAACAGTTGGCTCTTCCATCTTGGACGCTTCCAAGAGTCGATTTTTGACACCTTGGACGGCTTGCGCTATCCCTTTGCTCCGACCTCTTTGTT
GTTCTTGCAGCTCATATACTAACAAAACAACTGCACGGTCCTCATCGGTGCTGTTATCCAGCTCATCTAGTATCGAAGTATCATCGCCCAGCTTCTCATA
GATACTCTGCAGCGCAGGTGTTTCTTCATCAATACATCGATCCCTCCAAGTGCAGCATTGCAGCAACATGGTCCAACTCTTCACGAAAACTCCAGATAGC
GCTTGGGATGGCACGAACGTCAATGAATGGTAAATGTCCTGTAGCCGCTGCACCACTTGAGCAGTCATCTCCTCATATTCATGAGTCAACGCGCACTGCT
CTCACATTGTTTCCAATGTCCTAAAAAGCAGTGGAGTTCCACTATTTGACTGGTTGGAAAACGACGTCATCTCACCGCACTTCATGATGAGCGATTAAAC
ACCAGGCGCGAACTCCCATCGCGATATGGATATCAAAGGCGTTTCTCCATCGGCTGTTCGGACGTCCACACGAGCCTCGATCAAAGTACTGAATACGTTC
ATATGACCAGCCAGTGTGAGGCAAATCTCACATTCGAGGTACTGTTTGTTCCAAACCATCGTTCCATTCGCCGATGCTCCAGCATTCAATAAGCACATGT
CCGTGTCATTGTATTCGTGCTCCGCAGCATAGGACAACGATGTTCTTCCGTCTCAGTCCTTGTCATCGACAACATACGTGATCTAACAAACGCATACCGA
GCTCTGTGCGACCATATCATATGATAAACTACTTCCTTCTTCCAAGCTCGTCCTTTTCACGAACTCTTTCAATCAAACACTCAACAATCTCGGTGTGGCC
GTGGTCGACAGCATGTGACAGAGGGCTTCTTCTGTAGTTGTCGTTCTTGCCAACCTGCGCTTTTGCTTCAACCAAAAGCACAATGGTCCTACGATGACCT
TTGCCAGCAGCATACGATAAAGGAAGGACTCCTTCCGAATATTGTCGTTCTCGATGACATTTCCCCCTTGCTTCGATTAACACCACGGCAGCTTCTGAGT
GACCTTCTTCAGCCATAAACGATAGGGATTTTCTTCCGTAAGTGTCTTTTTCTACAGTATTCGCTCCTTTCCCAATCAAACGAGCAATTGTATCTATGTG
ACCTGCTTTAGCAGCATACATCAGTGGCGTTTCACCGCCTGTCTCTTTCTCGTCGACTCGAGCTCCTTCGATTAGGCGGATGACGACGAATCACATGCCA
CCACGGGAGGCTCGCACTCGTGGTTTTGTCGCCGTCGTGAGCTCCAGCTCTGATTAGAAACACAACAGTGTTGATGTGGCCTTCTTCAGCTGCATACGAC
AAGGCACTTCTTCTGTAGTGATTTGTCTTGTCGATATCCACTCCTCCTTCAGTCAAACGCGCAACAGTCTTTGCATGACCACTACCAGCCGCATACGACA
GAGGACT