Description :
From Genome Similarity Track
Location :
Scaffold_1799:1- 2782
Transcript NameFunction/comments
Phyra_43037polyprotein-like

Sequence
2781 bases(100 bases per row)
CATACCGTCCAGCATGCGCCTGCACGCAACGTTTTACGTTGGGCGACTGAAGCCGTACGTGCAGCACGAGTCACCTACGTCTGGTGACTCGCCAAAGCGC
TCTCGAGCGCGGCGACGCGCTTCAAGGCGCCAGAGAGCCTCGTCCCGACCTCGACCTTTACGTTCGAGGTCGTCTGCGCAACCTCCGCGAGCTGAGCCTT
CAACAAGCTCAGCTCCTGACGCAGAGCAGCGAACTGCGACGCTTGGAGACGCTCAACAGCCTCCAAGCGAGACTCAAGGTTTGGTTGACCAAACCCGGGG
CGTCTAGGGTTCACTTCCGTAGTCGAGGGGAACTCCCTCTCCACCCGGAGAGTAGATGCCCACTCCGGTTTCGACAGCAATGATCTTGCCTGTCTTTTTT
CGGATGGCATGTTTCTCATGCCATCTCGAGTGGTATCCAGCAACAGAGAGGCGACTCTCTGTTGCCGCGCTTGTCGTCATCGCCGTCGAGGCGATGCCAA
TAGCGGTTGTGGCGGAGGCAGCGGCCGTCGTCGTCATTGAGGCGACGACAACACTTGTTGCTGCCGATGCATCCGGCAACTTAGTCAAAGACGTCGTTGG
CGTGCTCATTAAGAATGAGCACGTGTTCTCCCGAAGAAATTCTGGATTGACGTGTCGGGACCGGCACGTCAAATCCTAACGGGGATGGTGTAGCGGGGCT
ACACATCCTACCTTAGTGCAACATGCACTAAGGAATACATTCAGGCTGACCACTCCATAGAGTGGTCCACATTCATAGCAAAGATATGACTGATAGAAAG
CAACACCTTTTTACCAATAAGAATCATTGATTAGATAGGGATTCTGCCATCCATCCAATGGCAGAACCTCTCATTAGAAATATCAATTTTAGGAGGAAAC
CCCATTTACAATCAATACACTTCTCATTTGGCACCAAAGCTATCGTTCGGTTCCTTTGTCTTAGTTTAAGTATACTTGTGGATACAAGTATACTGAACTT
AAGTTAATACACCTACGCTTCCTCATACACGTGCGCACACGTGTAAGCTTAAGTAGTGGGTCTGCTTAGACCCATTACAGCTACCATTTCTTTGGTATTG
CAGTACTGTATCGAGAATTCTTTTTTCGCTACTTTCTCTTGTACAAAGGCGTATCTAATGTGAATATGTTTCGATTTGCCATGCAATTCGGGGTTGTATG
AGAGCTTGATACAGCTTTGGTTGTCCTCATATTTGATGATTGCATGAGGACTGGTGTGGTTTATTTCTGTAAGCAAGAGGTTGAGGAAGATCACTTCCTG
TATGCAGTGGCATAAAGCGATGTATTCTGCCTCCGTTGTGGAGAGCACGATTGTGTAATGGTTTCTGGATTGCCACGATATAGGGCTCCCACACATGCAT
GTGATGTATCCGCCTACCGATCGACGTGTGCCGGGGCAGTTGGCGTAGTCCGCATCTGAAAAGGCTGAGATGTAGTGCTCCGTTTTATACAGCGTTTTAT
AGCTCAAACTTTTGGATACCTCCTAAGGTAATACCGAAGTTGCGGGTGCCATTGAGGTATTTTAGACCTCTCTTGACCGCATTCCAATGAGCTTTACCTG
GATTTGCGAGGAATTGACTGACTTCTCGAAGGAAGCAAGCTAGGTCTGGTCTAGTTCCCTTCATCAAATACATGAAGCTACCGACTGCCTCTCTGTACGG
GATCGCAGACATCTCATCCTTCTCCGCCTGCGTTGCAGGGCACATGTTAAGTGAGAGTTTGATACTCGAATCGGTTGGTGTACCGAGATCAGATGAGAGA
AGCGGTCCAGTACCTTGGTAGCGTACTTCTCCTGGTGGATAAAGATGGATCTGTTTTTCCGGTCTCGGACGATCGACCAACCGAGGAGATACTGAGCTTC
GCCAAGGCCAGACATTNTGAAGCGTTTTTGAGCGCGTCCTTAATGGAGGTAACGATAGCAATCGTAGGTGCTACGATAAGAAGGTCATCAACGTAGACTA
GGATGTAGCACGTATGTCCATCGACTTCTCCAACGAAAACGCATTGGTCTTTGGAGAGTTTGCGGAATTTCATGATTACCAGAAAAGTACATAGTGTAAG
GTACCAGATCCGAGGTGCTTGTTTGAGACCGTAAAGACTCTTCAGTAGTTTACATACCAATGTTCTTTCCCTCAAGTGGCAAAACCTTCGGGTTGCTCCA
TGTAAATATCTTCGTCGAGGAATCCATTTAGGAAAGCCGTTTTGACATCCATTGGATGGATCTCAAGGTCAAGAAGAGCTGCTATGGTGAGTAGTAGCCG
GAGGACTTCCATGGGGATAACGGGTGAAAAGATTTCGTCATAATCAATACCGTATTTTTGAAGGAATCCTTTAATCACCAGTCGTGCTTTGTAGCGATCG
ATCGTGCCATCGCCTTTGTATTTGACAACAAACACCCATCGGCACTGTAAGGCTCGTCTTCCTTTGGGTAGTTTTGTAAGTAGCTACGTTTTGTTTTCCA
TCAGTGACTTATACTCGGCGCGTGTGGCACTTTTCCACTGGAGTGCTTCGGGTAGACGCGTTGCTTCTCGGTATGTCTTTGGTTCCGAAATGTGTCGGAT
CGCAAGCAATGAGTATGTTTGTCCCTCCAGCGCTCGTCGTCCTCCACATCGAGTGGATCATTGAGGAGGTGTATTAGATCTGTGTGTTCTTGGGCGTGTT
TTGCCTTTTTGTTCGAACCTTTGCTGTCGTCAGCTGCAAGTGCTGTCGCGCTGCGTTTGAGCATTTCAACGAGAGATGGTA