Description :
From Genome Similarity Track
Location :
Scaffold_1263:1- 2753
Transcript NameFunction/comments
Phyke_g11728hypothetical protein

Sequence
2752 bases(100 bases per row)
AAGCGATTAACAAGCTGGACATGGTGAAGATTTTGATGCGTATGCTAAAGGAAGCAGGGATCGTGCCTGGAGCGTTTGACGCGAACGATCTATTTGATCT
GGAACTAAACGAGATCGAGGAAGCGACAGTGTCCTTGTACGAGAAGTTGGCAGTCCTGGTTGGTGTTGCCGCCCCGGCGGAACTACCAAGATCACCGACT
CCCTGCAGTCAAACTGGATCCTCACAGTATGGCGGAGCCATACTGGAGACTGGATCTGGTAGTTTAATTGAACTGCAAAGAATGACACTCGGACCGTCAG
GAGCTGCCATGCTCCAAGCTCGCAACTCAGGAATGAGATCGCCGATCGTCGCAGAACGGAACCAAGACCAAGCCTCGCCTGAACGTATGCAGACGTTCTT
CAACGCAGCGATGACTCGCTACCTGAAGGAAGAGCGAGCTGCAGAATTACCACAAGCGGCGGACCACTCGAAGGTGCTCGGTACCCAAGATGTTGAGATG
GAGTCAGTTGGATCGCGTCGTCGAGATGTATCACACATGAGCGAGTACGACCCAGACGATCTCAGTGTCAGCAGTCCGCCCCGAGCTGCCGTAGCATCTG
CAGAAACCTCCACTGGTGGAACCACAGTGACTCCACGAATCAGACTGTCCGCGATGTCAGAGCTGAAAGAGTTTTCTGGgaaagacaacgacgaggacCG
CGCTAGAAGCTGGCTCAGCAAGCTGAAGTCCGCCTACATTCGCGATCAAGCTCCCGATGACGAGAAGTGCCTTGTGTTCGGCGACCTGCTCACTGGATCG
GCGCGAAACTGGTATCGACAGTTAAGCCGATCGACACGGAGTAATTGGGAAAACCTGTCCAAGGTTTTCCAGATGCAGTACTGTGGCTGCGGAGTGTCTG
TTGCTAGACAGTACTATCATGCTCGAAAGAGATCGGAAGAATCGCCATTGGAATACTTGTATCGGCTGAACGTAGCAGGCATGCGTGCAAATCTTCAAGT
CAAGGATGGATCGCCCGAAGTCCAACGCGAACACGTGGATCACTTCATCGAGACGCTAGATGATCGTGATCTGGCTAACCAGCTAGCACTGTTTCAAATT
CCCGATGCTGACGCTCTGGAGGATACACTGTGATCCCGACAGCGTGCCAAGTTGAGGCAAAGCAAGTCGGTGTACGGCTCGATCAAACCCCGGCCGAAGG
CACCAATAGGTGCAAACCCGACCGCAACCGCGAGAGCAGTCCGAACGATCCGTACAGCTGCTGTTTCAAGCGATTCGGAGCTTGAGTCGAGTGGATCAGA
AGACGAAAAGAACCTGCATAAGATCTACTTAACCTCGAGCTCAGAACGAGCTAAGGAAACAGATCAAGATCGAACGGATCAGGATCAGGGACGTCTCAAC
CGGAATGTCAAGGATCGGCAATCGGATCGACCTATTGGATCAACGAAGGAGGGAACCTCGCCAAGACGTTGCTCACACTGCGGATCGAGCAAACACAGTA
ACCTGGGTTGCTGGCAACGATTGACGTGTGAGAAGTGCGGCAAGAAGGGCCACCCGACGGATCGATGCCTTTTCGTGCGCAAGGCGTGTGGAGAAATTCA
CGACGCCGGTCAATGCTCGATGGAAGAGTTCTATAAATTGATCCGTCAATGGTACAACCCCATCAAGCATGGAGGGATGTTACCGCAAGCGGCAGAGAAG
ATGTTAAACTAGGACGCTCGCCGGGTTTGAATCCGGTACGAGACGAGCGTTCTAGGTATTGCGTCTATGCATATGTCGAGAAGCAATCGAAATCTGAAGT
AAGCAGGCTGATGAGTCCGATCGACAATACATATGATCTTCATGGGAAACGTACCGCGGCTGTGTCAAGTTTACATCAGATCGACGAATATTCGAGATCT
GAGGTGACAATGGCCTTGGATATTTTACCAGGGGAATCGCGTGGATATTGGAAGTACCATGTGCCAGACAGGAAATTCCGGCAGGTGAAAGCTGTGGGGA
AGATCAACAATGAGAAAGCCACATTGTTGTTTGACAGTGGCGCCGAAGTGTCCATCTTGGACGCTACCTTTGCTCGTAAGGTTGGGTGTCAAATAGATGA
CAGTAAGGTGTTAGAATGTGAAGGTGTTGATAAAACCCCATACATGGCAGATGGACGTACTCGGCTCAAGATTACTCTTGCTGGATCACTGGTGTACCAC
TTCGACGCGTGGGTTGGCCTGCCAACAGGCGGCCAAGACTTGATCCTAGGTATGGACTTTATGGTTCCTGCTGGTATCCGCCTTGACCTTGCAGACGGAT
CGATCTGTTTGCCGGATGAGGTGCGGATACAAATGGCGGGACGACGTCCGCTCTATGGAGATAAAGTCGAACACGTCAAGCTAGAGGAACATCGACCGAT
TGCGCCGGGTGACTCGATCGAGTTACAGAAGGGTTTCGTGCTGACAGATCATCGGAAACTGTGGGTCACCCGTGGAGATCGATGGGTGCCGAGTGTGGTT
GCTGGATTGGGTAAGACACGTTATCTGCGAATAACGAATGTGAGCGATCGGAGGTTAGTACTCCAGAGAGATACTCGCCTAGGCATTTGGCTGGCAGGAG
ATCGTGTACCTCGTTTTCCTGGATTCGTCTCGATTGGTTCACGTAGGTATGCCGAGTGGCAAAATCTGGTTTTCCAGAGTATCGTCGAACATCGAGACGA
TGAACAACCTGATGAAGAACCGCCGGGAACACTCTTAGATCGACCTCAGTAT