Description :
From Genome Similarity Track
Location :
Scaffold_203:1- 2734
Sequence
2733 bases(100 bases per row)
AGCTTAGAAAGTTCCTATATTACTAGCAGAACACGGTTTCTCACTGTAAAAAGTCCCGAAAGACTTTCATCCTTCTGCTCAAAAAGTGCCATACACAATA
TTTGTAATTATTGTATGGTGAGTAACCCTATGCTAAGCAATAAGTTTGGATTACTTGATTGCAAATCTTGATATGCACGTTAGACACCCATCAATGTATT
TTTTCAAGGTAAAAATAAAAATGCCCATTTAATCACGAAAATATAAATTTGTTAGACAACCGTCAATGTATTTTTTTAAGGTAAAAATAATAAATGCCCA
GTTAATCACGAAAACATAAATAGTCAACATAATGAGAAAATCTAAAGAAATGCGCCACGTCCTATTATACTCTAGTTAACGTACTACACATAGAAAATAA
TATCTGTAGTCATTTTTCATTCCCATTGTACGGCCGTGCCTAACCCCCGCCCTGTAAAAGGAGCCGCGGAGGAGGTTCTGCCGCGGCGTGCTGCACTCGC
AGCTACAAGTTGCGGGCGCAGGGCACAGGAAAGACGTGAACGCGTATTTATATCGTCGGCTGCGGTCGTAAATGTAGACAATCGGTGCTGTTGTAACTGA
TAGTATTGTTTTCATAATCGTTTTGTATTGTTGTTATTGTTTTCTAATCTTATAATTGTAATTTTTCCAGTTGCTGCTATTTTCTTGCCAGCGTCGCTGT
TGTTGATGTCGTTGTTGCTGATACCACTGTTGCTTTAGCCGTCTTTGTTGTTATCGTAAGTTATTAATGTTGTTCTTTTAGCTTCTTTTTATGCTGCTGA
TTGTTGTTGTTATTGTTGCTTTTGTTAATGATGCTCATTTTGTTTTTGTCACAGCTACTGTTACTGATATTAAAATTGGTACAGCTGTTGTTTTTTCCTG
CTAAAGCTACTGCTGTTACTGTTACTAATGTTTTGTGGTGTTGTTGGTGACGTGGTGTAAGGATTTTTCGACTTGGTGTACCCTTCTGTTGGCTGATTAT
GAGGGTCGGAACTTGACGAGGAAGAGGGGATGGAACTGACGCAAGGAGATGCGACAATAGTGTAAAGATTAGGCAATTCAACTCTTGTCGATACCGGGCT
CGTCGAGTTCAGGCTAGTCGGATTGACAATCGTCGAATATGGTCTCGTCAAGGTAACAACCGACGATTTAAGACTCGTCGAGTTCAAGCTAGTCGAGATT
AGACTCGTCGGGTTCAGGCTCAGCGAAGCAGCTGGAAGCTCGACGTTCCAAGTCACTAGGTAATTGTATAGGAGAAATAGGGGAATTAACGGGAGCCACA
CAATAGACTCCGTCTAGTAGAAAATAGATACCTAAATCCAGGACAGAATTTTTCTAAGTCCAAGAAACGTGTACGCTTTTTTGGTGAGTACCTGCGTGGG
CTGGATTATGCCTGCCATCGAACCTCGAGAGGCATAGCTTGTAGAAGTCTCGGCTGGAAGCTCCAAGAGATAATTCGGCCCGTGTGGGCATTACTCGCTT
CCAGAGAAAGATCAGTATCGTCGCACGGCGAGCCGGTAGCCCAATAAACGGCACCGTTTTGAGTCCCGTCGAGCGACGAGTCAGTGACCCAATAGACGGC
ACTGTTGTTAGACTCGTCGAGCGGAGAGCCGGTGGGACTTTAAACAAGGAAGCCGTAGGTATTCCTGTGGGGTGAATACTGCGCCTGGTGACCTGTAAAA
TGCTGAAATCCATCCGTTGGTGTGAAGTCACAGGATTTGAGGAACGGAAGCCGCTGAGCTCAGGAAGGCTTCTAGACGTCAGAGTGGTTGTGAGTCCTCA
GCGAGGGCGAAAGACACAACTGAAGCCGAAGGGGCAATCCGCGAAGGGATTAATCCCGACGTACCATCCCACCTGCGCTGATTACTCGGCGTTTATTTTG
TTGTTAAGTTGAGACTGTATTACCGCAGATTTAAATTACTACTAAATCACAACTGGTGCCTCGACCCCGGAGTTTAGGGTGTGCAATTTGTTTCAGTAGG
TACCAAGCAATTAAGGAAGGTATGGATAACATATCGAGCAATGTGAAGCAGTGCGAACCCGGCAACAGCTGGACGAGCGCCGCATGCTGGGACAAACTCG
GCGAGTTTGGAGATCATCCTGGCTTAAGCGGCGGTGGAACGAGACATCCCAGTTTGACGATCTCGAAGCAAGTGACTAAGATAGCGAGGAGGATGGAGAA
GATGAGGAAAAATGACAGCGTTGTAGACAGCGATAAATAGGAAGATGGTTTGGTGCATGTGGGCCATGGCAGCAACCCTAGCGGGGTTGATAGATACGTG
GCCAACGAGCTCGACGATGAAGAAGACAGAGGTCAAGACGCTATCCTTGGTAAGCGATCCCGCTATCTCCCAGGGCCACATTTAATGTCGGTACCCCTAT
GGCTGATCTAACTATGAGGTGTCGTTAGTCAGCTATTAGCTACAAACACTCAATATTATGTCGCTAGAGCAACTGGCCGACAACACCGTGTTTCTGCTAC
GAGCAATGGGATACAAGTTGACACTAGGCCCTTTAATTTGTTGTTGGCAAATTTCAAGACTCGCTCGGCGGGAGTCGAGATGATGAAGTGGAAGCGCAAG
CTGAAGGAAGCGTTTGGATTCGAAGGCGGAATGAAGTCGCAAGTCCCGCTGAATCGTCGAGGGCAGGTAGACAAGATGCTCAAGAAATTAAAGACACCAG
CGCCACGTCACGACGAGAGGAACATGAGAGATT