Description :
From Genome Similarity Track
Location :
Scaffold_2971:1- 2705
Sequence
2703 bases(100 bases per row)
CTCGGCGATCCGCTGGCTTGGGGACGATATGCCATGGTTGCCCGCTGCCTCTGCCCCAGTGAAAGCTCGAAAGAAATCAGACATAAAGCCTGGCTACCGA
TCATGCCGAATCATCTCACTAGCTCCAAATCTCCGAAAAACACACTCCTCGTACGATCCGGTGATGGTTTGTGCAGTTCTGGACGCGCCGGTTTTGGCTA
TCACGTATCCGGTAAACAGATCCACCCAGATCAACAATTCTGTGTTGCCTTTGAATGACATGGGGTAGCGAGGGGATGTGATCCAAGGCTATGATTTGGA
ACGGGTAAGTCGCTTGGACGTTCCCAGGTGATTCCCCTTCGTTTGTGGGTCTGCCCTTGCCTGTATCACAATCCACGCATTCACCGAAATCTCGCTGCAC
ACTCTTGAATAGTCCCCTCCAGTGGAAACATTTCCGGATCCGTTGGTAGGTTCGACCAATTTACAGATGTCCTCCTTCTAAGCTAGCGTGATAGTGATGT
AGGACATCCTGTTGCAAGGATTCCGGCATCACCAATCTTATCAGTCCGTCTCGATCCCCGCTGACTCGTTTCGTAGGGGGATAATAGAAGAGCAAATCAT
TCAGATCCACTGCATAATCCGTAGCGATAATACTGTAGGATTAGGCGTCCTCCCGACTCAGGTCTCATACATCCCCCACCAGATACTTCTTAAGTCCTAG
GATCCACACTTCTTCGTTATGTGCTTTGAGAATCCGCTCAATACGGACTCCCTTCACAAATGCTTCATCGAGAATCTGGGGGTTAGATCCAATCCTTCCT
CTGGATCTAGTGACAGCCATAACCTGGACCGCCCGCTTCACGGATCCAACCGCCACCACTTCGTCTAGTCGGTTCGATGTGACGAGATCCTGGTGATCGG
CCTCTCTCTCCACCTCGACACCACATTGATTCCGTAAAGCGGCACTGGCCAAGCTGTCTGCACTGGCATTCCAATCTCGCTTGACATGCACCAACTCGTG
ATTCAACCAACCCCGCAGGTGGATCATCACTTTCTGCCGTAACAGTGTTAGGGCCGGGGCCTTGCAGTCAATCTCACCTCGCACCTGTCTGATAACCAAA
TTGGAATCCCCACAAATCACCAGCCTTTTTGGATCCTGTCCCTTTAGTAGATCCAAACCCAGCAGGAGTCCGTTATACTCCGCTTCATTGACGGTGAGGC
CTTCCGCGTAAGTGGATCTGGCCCGTACAACTTCCCATCCAGGTAGTCTCCACAGTATTGCGCTGTATGCTCCTCCTCCGCGTCGTACGCGAGCGGATCC
ATCGAAACTCAGGCCGTACAGATCCTCGTCTGCCTGTACCGTCGGGATCGGGATCTGGATCAGGCGTTTGGGCTCTTTCTTAGGAGCGACCCTAGTCAGC
GCCTCATCCATCTTAGCTCGAGGAGTGATGCTCGCGGCCAAGACTCCCAGGATCTCGTCTTCCCCTTTCGAACATTTCACAATCTCCAGCGTCCAAGGCG
AGAGTAAAGCCGCCCACTGTCCCAAACGTCCTTGCAACCCGGCCGACTTGAACAGCCAGGCTAGCGTGGAGTGTCGAGTCAGGATCCGGATGGATCTTCC
CACTAGCAGGTTATAATTTAGATCCAACACGCGCAGGAGCGCGAGTATCTCTTTCTCCACCGCTCCGTAGTTCAGTTCATTCGGCTTCAATGTCCGGCTG
ACGAAGGTGACTGGATGACAGATCCCCTCATGTTCTTGTACCAGAGCCGCTGAGACCGCCCGGTCACTGGCATAAACTATCACCGTAGGTTGACGTTCCG
GATCGAAATGACGGAGGATAGGCGTGGTCGCGATTCTGTTCCTAGGTTCCATGAATGCTTGTTGAGCTCGGATCCACCGAGATTCTGTCTTTTCCACGTT
CTGATCCGTCGTCTCTATCCAGACTGGATCCTCTCTCCGTTGGTCCTGGGGTGGATCCAGCTCCTGTTTTAGGTCCTCTTCTGACGTCGTACCACTTGGA
TCCCTTCGTGGATCCGACATCTCCAGGGCCAGAGCTTGTTGGATTTTGATCCGGACAGCTGGAGTGGTCATCGCAGCAAAATCTACCTCTCTTAATTCAT
ACAATACCGCGGCAAACAGGGCGTAATCCTCGATGAACCGACTGTAGTAGTTCAAACTGCCCAAGAAGGATTGCATCGCTCGTAACGACTGTGGGAAGGA
CAAATCGGGCTAATGAAGACAGGTCCTTAGGATTCGCCTCCAATCCCTCCTTGGAAACTCGATGGCCTAAGTACTCCACCTTGCGCATCCCCCAATAGCT
CTTTACCACACTGATAGAGAGATTCCACTTAGTACACGCCTCCAGTAGGGATGTCACTCTCTCACACAGCTGATCCCACGATTCCGCCGGGATTAGGATG
TCGTCGATGTAAGATCTGCGTCCTAACACAGACGGGGTCCCAGGATCCCCTGGCTCCCCTGCTTCGAATGGATCCACTTCTGCATTTCCTCCCCCGGATT
CACCCGTTTCGGGCTCCGGTATTCGGGTGAACCCATAGAGGGCGTTATCGATCAGGCGTTGGTAGATCTGGGGTGCGTTCTTCAATCCAAACGGCATCCG
GGTCCACTCGAACAGGCCAAACGGCGTGATGAATGCGGATATTGCGCGAGCTAAAGGCCGTCATAGTAACCACCCAGAAACCACTGGCCATGTCTAGAGA
ACA