Description :
From Genome Similarity Track
Location :
Scaffold_855:1- 2700
Transcript NameFunction/comments
g17623.t1hypothetical protein

Sequence
2699 bases(100 bases per row)
GCTGCTGATCGTGGACGAAGCCAGCGGATGCATGAAGGGGTTCTGTCTGCGTGCCAAGTCGGAGAGCGAAGACTGCATCAAGACGTACGTCACGAAGGTG
CAGACGCAGTTCGGCAAGAAGGTCAAGTTTGTGCGGCACGACGGAGCTCGTGAGTTCGCGACCAACTCGCTCAAGGCCTTCTACGAAGTCGAAGGCATCC
CCTACAAGTAACAGAGTAACCTGTCCGTCCGTCCGTCCGTCATTCCGTACGCACCTCGAGCGTAACGCAAATCCGGACTTTCCGTTGGCTATAAATAGCT
GCCGAGCGCAGCGAAGGCGGCCTCTCCATTCGCTATTATTATAATACGAGACCTCTCATTGGCTATATATTCGAGCCTCTGCGCGATTGGCTATTATAAT
GCGTAGAGTGAACTACATCACATCGGAACTAGCCGAATGAAATCACTGCTGATTGGACAAAATAAACCGCCTTTCAACAACGTTTCTTTTCATTTCCATT
TTCAAAACGACGCTCCGGCGACGGACCAGCTCAACGGAGGACCGGGCGGGATAGCTTCGCAGGCAGGTCATCCCCGCCGCAGGCAGGGTAGGTATAGATT
AATCCTATTTAATTCTAATACATAACGATTTCGGGAGTGCCGCCTGTTGCGGATAACTGGTACCTTCAGGGCAGTCGAGGGGTAACCGTGCGTGTTAGAG
GAGGATAACCGGAGCCGTGCATTGTGTGGGAAGGGCACAACTGCATGGAGGGATGGGTACCCTATGACGGCCACACTGATGCGGCCTAGCCAGCCCCCAA
GAGGATCCCATCCCTGCCCAGCGAGCCAGGCCGACCTCTCTCGAAGCAATCGTGACGGTTACCCCGTATTTTCGGGCTTTCTGGTGAACATGCTATTTTG
GGGGGCTCCCTTCACCCCCGGGAAGCAAAATTCCAGGTTAGAGGTCCGATAAAAAGATTGCAGCTGGCGCCCGAAATGCGTTCCAAGACAGTCCGCCATC
CAACCTGCTCTTCGGAGCCGCGGTGCTGAGGCGCCCATTTATGCCCGCCGGCATAGTGGGAAGTCTCATACCAATCCGGGGGACTGGGATGGGTACACAC
GGCGATAAAAGCCGGCCTAGCCGGGTCGTCCATCCTAGCCCCGGGCTTGACACCGTGTAATGGGACCGGCCCGTAGTGTGGTAACATGCTATTTGGGTTT
CTGTGCAGTTACGGCTGTGGCGGACACTTTCCAATCAAAAGGACGAGTCGGCACTATTGTGACAAGTGAGGACCGCTCGACGGTGGCCATTTGCAGTGGT
ACCGGTGGAAAACCGTTGGTTTGGTGCAGTCTGCGCTCAAACTCGGGGTTTGTACGGCCCTTTAATGCCTATGATGCCTTGCTGCTAAAAAAAAATATTA
AAAAAGATTCCCAAAAAGCTGACACGTGTCCCTTTACAACCAAAACGGTTAATTGCCTGAGCTGATAAAGCTCAGTGGCATTGAGCGCGACCGGTAGACC
TCCGTTGCCAAAGGAAGCAACTAAAAGAAAAGAAAAAAAAGAATTGAGGTACCGAGTCGCGCTTCAGCACCTCGAACCCGCAGCTGTGTCTCCAAAGGTA
TTGAGACGCAGCACCAATGCGGGGGTGCTTTAAAGGGATAACGGTGGATGTGAGGGACCAGAAACAAACAAAAGCAAACGCGGCAAGGCTAATGAGGTGT
TTTACAGCCGTGCAGGACTCGGGTTCGTGGCGAGGACTGTGCAAGACTGGCGGTGCTACACGGGTATCCTGCAGGTGTGTCTCCAGAAGGCGTCTCCTTG
CGAATTGCGAGGTACCGGCCGTCCTTTTACTAACGACTGCAGTTTTGGGTGGTTGTTTTCCAATGCACGTGCGCATTTATTGGGAAGTCCACTAACGCTG
CATTTGCTGTTGCAGTTGTTGCGGACAGCACCATGGTGAATGTCGGCAGCAAGCGGGAGCGGTACGGCTGTTTGTTGGTTGTTGTCAAGTGTCCCTTGCT
CAGGGGTCTCTTTTGTTAGTGATGAGCGGCGTCAGGAGCTGGACCAGCGCCATACCCAGGCCCTCGATGCCAACGCGTCACCACAAGGATATGAGTCTCC
AGCATCTAAGAGGCGACGGTTGGGGCGCCGCCGCGCGGCTCAAAGGCGGTTTCGGGTGGCAATGGAGCAGATGGAACAACTGAGCCTACAAGAGGCGGCC
GCAGGTGGAGGGGACGTCGTCACAGTGACAACGGGTGAAACCGCCCCTCCTGTGCCGACGGTCGTTGGACAAGGGGCGACTAGCCAGCTCTCTGCAGGTG
CTCCAGTGCAAAGGGCGACTGACCCACAAGCAAATCCACGTCGGGTGAGGGAGGCGCAGCGAGCGCGTTCCAGACGAAGTAACATGACCGACTCTCAGCG
GGAGAGTGCGCGGCGGCGTGACGCGGAGCGAAAGCTAGCCCGGCGAGCCCAGCTCCGTGCCGAGCAGCTTCAGGACGTACGAGAACGAAACCGGATCGCA
CAGCAGGAACGTCGGCATAATCTGAACGAAGAGGTCCACGCCGCGGAGCGTGAACGCAACAGTGCTTCTCGCGCGCTTCACAGGAGTGTACACGATCGCA
CTGAAGAGCGCAGGACAGACCGGGAGCAACACGCGGACCGCCGGGTTCAGTTTACGCAGGAGGAGCGTGCTGAAGCGCAAAGGGTAAACCAAGAGCAAC