Description :
From Genome Similarity Track
Location :
Scaffold_2599:1- 2673
Transcript NameFunction/comments
Phyag_g12628hypothetical protein

Sequence
2671 bases(100 bases per row)
TCAAAAGTCAAATTTGACAGCAGTTTAGCTTCATGTGGCGCCAGCGGTAAAGCCAACTGCTCGGTAAAAAATAGCATTTGGGTCCGGCAGCTATAGTTGC
AGCTATATTTGGCATTGAATATAGCATTCCGATATAAGTAATTCTTGTCCATTGCGAAAGATGAGCATTCGTGGAGCAAACTACCGGTCGGCAGAAGACA
AGATCTTGTGCGAGGCGTGGCTCGAGGTTAGTTGTGATGGAGGGACAGGTACTAACCAAAGTGGCGACGAGTTCTATGGTCGAGTGAAGGAAGTCTTCGA
CGAGACTATCAGAGAGCAAAACAAGTTTGTAGCTGAACGCAAAGCAGGATCACTCTCATCAAGGTTTCAGATAATTTCGGCTGCTGTGTCCAAGTTTGTT
GCTTGCCATGCGAAAGTGTCAGCGTTGGAGCTAAGCGGACGCTCTATTGCTGACATTGAGCACGAAGCCGTCGAATTGTTTGAGTCTGATGGTAGAAATG
GGAGGTTTAAGTTCatgcactgctggaagatTCTTCGGGAATCAGACAAATGGGGTGCCTGGCGTGCGGATATTCAAGCCAAGAAGTCTCCGAACAAGCG
CACACGCGCACCAAGTTCTGACACTGGAGAATCTGTTAATACGTCGTCAAGCCAAACGCAGGAAGCAATCTCCACAGATATACCCCGTCAGGAACGTCCT
GTAGGTCAACAGAAGTCCAAAATGGAGCGCTCTAATCTTGCTCTGTACGCTCGTCAAGTTCAGGCAACTGAGCGCATGGCCAAGAACGCTGAGCTTCGCA
ATCGTGTCGCTCAAGAACAGGTTGAGCACAACCTTTTCAGTATGCAGCCTAatgaaggcgacgaagaaacAAAAGAGTACATTGCGCTGAAGCGAAAGAT
CGTACTTGCCCGTCTGCGCAAGGAGGCAGCGCTGGCGGAAGCTGCGAATTCAACAGGCGGTACGTATACCAccgctggaggagacgaaaTTAGTGTTGCG
GCACTGCCACGTGATGCCGACATTATTCTGTCGCTTTAATCAAGAGTTTACTTGTCGGTGAAACTAGAGGTCTCACGGTAACACTGAATACATCAATGAC
GGAAATGTTTTCGTAATTTATTTTATATCATAGTAGAATGAAAGGTACTCTTAATCGTTTGCGCCGTGCAACTTCCACAAGTGATCCATGAGGTCGTCTC
TCAAACGGAAGTGCTGGCGTTTGCTATGCAGCACATGTGAATTTGCAATGAGATCCACCACATTagctggacgtggtgaagTAGACGGACGAACCACTTG
AATATCAGGAAGTCCTCCTggctgcgcttcttcattAAAGAGGTAGTCGTTTGATAAGTTAGGGTCATCGAGTTCGTCAACCACGATCATGTTGTGTAAA
ATGATACAAGCGTGCATAACAGTACTCATCGCATCTGCGCGCCACAACCTACACGGTGTTTCAAGGATACGCCATCGTGCTTGTAAAACCCCAAAACAAC
GCTCGACATCTTTACGACACGCCTCCTGTCGACACGAATAATACTTTTGTTTTTTTCCTTGTGGTCGCTCAATGGATTTCACAAATACAGCCCACTCAGG
GTATATCCCGTCCGCCAACAAATAAGGTGTGTAGTATTTGCTCCCTACACATTAATCACATGCACGATGTAAGTCACGAAGTTATATTGTATCCATCTAA
TAAGATCTTACCGTTGATAGTATACTCGACACGGGGAGCTTTACCTTGTAGGAAGTCATCAAACAAATGCGACTGGTCTAGTATGTTGATGTCATTAAGT
GATCCAGGGGAACCAAAGTAGCAGTGCCAAATTCGTAAATTGTAGTCTGCGACTGCTTCAAGAACTTTAGTCGGCTTTTTCTCTTTCCCTTTATGCTGCC
CTGCCACCGCTGTTGGACAGTTCCGCCATTGCCAATGCATACAATCGACTGAGCCTATCATACCAACAAAACCACGACGCGCATTTTGTTCAAGGATCGC
TTGCATCTCCAAATCTGTAGGCGGCCGAAGGAACTCTCCTCCAAAACGAGCAATAATCGCCTGACAAAATCGTTTCAAGCTTTCTAATGCTGTGGGCTCC
GATAGTTCTAGATTTTCATCAattgcatctgctgcagtcgaatAAGCAAGCTGCCGAAGTGCTGCGGTTACTTTGAGAAGACTCGAGATTCCCCATTTAC
CAGTAGCATCGCGTCGTTGGGCGAAGTACGGATCCGTCTCCACAACTCCTTGCAAAACGTGAAGAAACAAACGTTGAGTCATCCGAAAACGAGTCCTGAA
ATCACGAGCATTGTAGATGGGGTCCGGGCCAAAGTATTGATTCAAAAGCCTGAGATGTCTTCCAGCGGCATCCCGGTTTTTATTTGGTGCACGGCCTGGT
CTTGACCCCCCAGGCCTTGATGGCAGCTCAACACCCCGTGGTTTTGCTTCTATAGCGGCCATGAAaacagcatcttcttcatcggctTCCTGAAGAAAAG
CGTCCACCCACTCAGCTCCTGTGATTGCATCCATTATTGTCCGATCACAAGTGTTTGTAAAATAGCTACACCGCTAGAAGAGTTGATTGATGCCAGTGCT
AAAGCTATAAAAAACATGTGGTTCACTTGCCAAATATAACTTAGAAATAGCTTTACCGCTGCGGACACTCT