Description :
From Genome Similarity Track
Location :
Scaffold_2047:1- 2665
Sequence
2664 bases(100 bases per row)
GTCGAGCCTCCTTCAGAAGGACGTCGACTGGCGCTGGGAGCAACATTCCAGGATGCTTTTGACAGCATCAAGGCCAGCCTCCAAGATGCCCCTGTCCTGG
CCCTGCCGGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCGATTACGCCATCGGATGTGCATTGCTGCAGGCCGACACGGCTGGACACGAACG
AGTCATCTCGTTCCAGTCCAGGCAGCTCAAAGCCGCCGAGCGGAACTACCCTGTCCATGACAAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAGTTC
CGTGTTCACCTTCTGGGCTCTAGACCATTTGTAATCTACACAGACCACGCGTCCTTGAGGACGGCGACTAACTCGCCTCACCTCTCCCAAAGAATGGCGA
GGTGGCTGTCCTTCTTCGCGGAATACAACTTCCGCGTCGAATACAAGCCGGGCAAGCTCAACGTGCTTGCGGACGCCCTCTCTCGGCGTCCCGACTATGA
GTTGGCCCACATCACGCGGGTGACAACGGATCTATATGATCGGATACGCATGGCGTATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGTTCCTTAAG
GCCGGAGCCAGCGCGAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGCTGAAGGAGGGCCTCCTCTATTATCGGGTGGAGC
CCACTGGTCCTCCACGGGTGGTCGTACCCAACGACGAGGATCTGAAGTTCGACATCCTCGCGGAGGCGCATGACGCGCACTCCAGCGGCCACTTGGGCCG
CGAGAAGACCTTTCTGTCGGACTCTCAGTCCTTCTGGTGGACCCACATGTACAAGTGGGTCGCCCGGTACGTCAAGACATGTGAAACATGTCAGCGGGTC
AAACCCGCAGGGCACTCTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGGTTGTTGGAAGTCGATGACTCTTGACTTCATCTTTGGGCTTCCCGCCG
ACGGACACGGCAACACCGGAATTTTGGTGTTCGTGTGTCGGCTGAGCAAGATGGTACATCTTGTTCCAGTTCCCGTCACTGTTACGGGCGAGCAAACCGC
AAGGTTGTTCGTCGATGACGTGTTCCGCTATCACGGTCTCCCAGAGACGATTGTCTCGGACCGAGACCCACGGTTCACTGCTGCGTTTTGGAAAACGCTG
TTCCCTTTACTGGGAACTCGTCTGCAGATGTCCACGGCGGACCATCCACAGACAGACGGCCAAACAGAGCGCGTCAATCGAGTGCTCGAGGACACTCTGC
GCAGTGTGTGCGCGGCAGCACCACGTACGTGGTCGAACGCAGCTCTCCCAGTGTGTAGAATTTTACGCTCCCAATAATGCCGCTGCACGCCGCTCCACGG
CGGTTTACGCCCGTTTCTACTTGAAAGCGCTTTCGCCCACCCCCAGAGTGTCTCTCACTCTTCCAGAGACACTGACTCCTCTAATTCTCAAGTGGGTGAG
AGGCTCGGAAGCTCTTTCTCTCAGGTCTCGGATGTAAGACCAGTTTCGCTGCGGAAACAGTGGAATCCTTTTTGGATACCAAGCTGAACATTGTCAGCAG
GGTCCGCGATGCCATGGCAGCGGCTCAAGATAAACAAAAGGAGTACTCAGACAAACAAGGAAGAGGAAACTTAAGTGTATTTGAGGTTGGGGACTTAGTG
TTGCTAGACACGAGGAACCTACCTCTAGACACTGTTAGCTCTGTCGGCAGCAACAAACTGAAGCACCGCTTAATCGGACCTATTGCAGTCCTGGCCAGAC
ATGGTGCGTCGTACACCATCGACCTTCCAAAGTCAATGACGACGCACCCGACGTTCTATGTCGGACGTCTTAAGCGGTACTTTGACCCGCAGGGGGTTGC
TGACTCGCAGTCCCTCCTTGACCCAGCTCCTCGAAGCGAGGGCCGGTCACAGTCGTCGACGAGGGCGTCGGAGCAGGCACCCAAGCCTCGGTCGGGACGG
CAAGGCTGCGGTCAAGGCCGTACGTCGGAGGGGCTCCATACGAACGGACCCCGGCGCCATACGCCGAGTACGCTGAGTACGCCGGGTACGCACCATACGC
GTACGTCTGGGAGTGTGCCGCAGGCGGCTCCGGACGTGGCAACAAAGCCTCGATCCGTCGGATCATTCGGAAGGCCTCGTCCAGATCGGACGAAGAGGCC
CGGCGATCCACCCGCAGGTGCAGGCTCGCGACCTCTCGCTCCACCAGGTCCAGGCGACCCGCAAGACGAGCGAGCTCGCCCTGATTCCCGGCCTGGGCGG
CAGCATTACCGCCAGTCCCAAGGCCAAGTGCAATCTCAAGCACGAGGACACGTTGACGGAGGCGGTCAACCTCAGGGTCCTGTGTCGGACCCGCAGTCGG
AGCACTCGGACGAGAGTGGCTCTCGGGAGGCGCCGAGTACTCGTACTCGTACGAGGGCACCTCCGCCCCTGCTTGACCGGAATGGAGAAGCCCACTACCA
CGTGGAGCGGATCCCCCAGGAGCAACGGTGTCGCGGCAAGCGACAGCTCCTCGTGAAGGGGAGGGGTTATGCCCACTTCGAGAACTCATGGGAGCCGATT
GAACGGCTCCTGATTGACTGCCCGAAGGCTGTCGCAATCTGGGAACAGAAGCGGCGGCAGCTTC