Description :
From Genome Similarity Track
Location :
Scaffold_3189:1- 2611
Sequence
2610 bases(100 bases per row)
TGGAAATGAAGAAACAAGATCGCGACCACGCCTATCTCCGTCATTTCGATCCGTAACGTCAACCTACGGTAATAGTTTATGCCAGTGACTGGGCAGTCTC
AGCAGCTCTGGTGCAAGAACATGAAGGGATCTGTCATCCAGTCACCTTTGTCAGCCGGACACTGAAGCCCGAATGAACTGAACTACGGAGCGGTGGAGAA
AGAGATACTTGCGCTCCTGCGCGTGTTGGATCTAAATTATAACCTGCTAGTGGGAAGATCCATCCGGATCCTGACTCGACACTCCACGCTAGCCTGGCTG
TTCAAGTCGGCCGGGTTGCAAGGACGTTTGGGACAGTGGGCAGCTTTACTCTCACCTTGGACGCTGGAGATTGTGAAATGTTCGAAAGGGGAAGACGAGA
TCCTGGGAGTCTTGGCCGCGAGCATCACTCCTCGAGCTAAGATGGATGAGGCGCTGACTAAGATCGCCCCTAAGAAAGAGCCCCAACGCCGGATCCAGAT
CCCGATCCCGACGGTACAGGTGGATGAGGATCTATACGTCCTGAGTTTCGATGGATCCGCTCGTGTACGACGCGGAGGAGGAGCATACAGTGCAATACTG
TGGAGACTGCCCGAATGGGAAGTTGTACGAGCCAGATCCACTTACGCAGAAGGCCTCACCGTCAATGAGGCGGAGTATAACGGACTCCTTCTGGGTTTGG
ATTTACTAAAGGGACACGATCCAAAAAGGCTGGTGATTTGTGGAGATTCAAATTTGGTAATCAGACAGGTGCGAGGCGAGATTGACTGCAAGGCCCCGGC
CCTAACACTGTTACGGCAGAAAGTGATGATCCACCTGCGTGGATGGTTGAATCACGAGTTGGTGCATGTCAAGCGAGATTGGAATGCCAGTGCAGATAGC
TTGGCCAGCGCCGCTTTACGGAATCAATGTGGTGTTGAAGTGGAGAGAGAGGCCGAGCATCAGGATCTCGTTACGTTGAACCGACTAGACGAAGTGGTGG
TAGTGGGATCCGGGAAAAGGACAGTCCAGGTGATGGCCGTCAGTAGGTCCAGAGGAAGGATTGAATCCAACCCCCAAATTCTCGAGGAAACATTTGTGAA
GAGAGTCCGCATCGAGCGGATCCTCAAAGCACAGAACGAGAAAGCGTGGATCCTAGGACTAAAAAAATATCTGGATGGGGGAAGTGTACCAGACCTGAGT
CGGGAAGATGCCAAACCCTACCGCATTATCGCTACGGATTACGCCGGTGGATATGAATGACTTGCTCTTCTATTGCCCCCCTACGAAGAGAGTCAACGAG
GATCGGGATGGATTGATGAGACTGGTGATGCCGGAAACCTTACAACAGGATGTCCTACACCACTATCACGCTAGCTTGGAAGGCGGACATCATGGTATTG
GTCGGACCTACCAACGGATCCGGGAATGTTTTCACTGGAGGGGACTATTCAAGAGCGTACAACGGTATGTCGTGGGAATGTCCAAGCGACTTACCCTTTC
CAAATCATAGCCATGGATCATATCCCTTCGTTGCCCAAGTCGTTCAAAGGAAACACAGAATTGTTGATTTGGGTGGACCTGTTTACCGGATACGTGGTAG
CCAAAGCTAGTGCGTCTAGAACTGCGCAGACCATTGCTGAATCGTACGAGGAGTGCGTTTTACGAAGATTTGGAGCTAGCGAGATGATTAGACATGATCG
GGAGCCAGGCTTTATGTCTGATTTCTTTCGAGCATTCGGATCCTGGGGCAGCGACAGCGAGCAACCATGGCATATCGTCCCCAAGCCAACAGGTCGGCCG
AGCGCATGGTACAGACGATCACGAGAGCACTCAAGATGTACGTCCAGGATTTGGATCAGAGGGATTGGGATGAGTACGCAGAACGGCTCCCCTTCGGGAT
GAACACCGCCCAAGACAGGATCCGGGGTGATACCCCATTTGACTTGGTACATGGGTGGGATCCCAAATCCACCCTAGAAGCGGCCATTCCGGTATGTAGC
ACCAAGAAGAGAAACCGAGATCCAAGGAGATGGCGATACCAAGTCCAGAAATACTACCAGCAAGCTAGATCCCAGGTGAACGAACGACTGCGGAGTGCGA
TACAGGATCGAGCGATTGGACACAAGGAAGAACGCCCTTCCACTTCAATTCCAGTGGGAATCGCCAGGTGGGGCCTATATTTGAATGGAATGAAAGGAGA
GGTTACGCCCCCCAAATTTGGGCCCTTTCTGGCCATGAACCTTTTGCGGGTGAGCGAGAAAGAATCGGAAGAACCCTGCGGTAAAAGCTGGAAACGGCAG
GTACCGAATATCGCCTGTTCCCTGTAGTACACGTATCCAAGCTGAAGTTGGTCAAAGAATATCCGGATCAACCGCAGATCCGTCTCTCGGTGGATAAATC
CGACCGGGTGGATTTCGACGAAGTTCTCCTACCGGAAGATAGTTGAAATGTGGATCTCGAAGCCGACGAGTTCGAAGTCGAGAAGATCACCGATATGAGG
TCGGGGAAGCGAACTAGATACGGACGGAGTTACCGTGAATTTCTGGTGTATTGGCGTGGATATGACGAACCCAGTTGGGTAGATGAGGCAGATCTGAACT
GTGGAGCATT