Description :
From Genome Similarity Track
Location :
Scaffold_3252:1- 2598
Sequence
2597 bases(100 bases per row)
GGAGTTGTACTCCGCGAAGAGTACAGCCACCTCGCCATCCTTTGGGAGAGGTGAGGCGAGTTAGTCGCCGTCCTCAAGGATGCGGGGTCTGTGTAGATCC
CGAAGGGCCGGGAGCCCTGAAGGTGAACACGAAACTTCACAAGGGAATATTTCATTGCCAGGAGCTCCTTGTCGTGGACAGGGTAGCTCCGTTTGGCGGC
TTTGACCTGCCTGAACTGGAACGAGATGACTCGTTCATGTCCAGCCGTGTTGACCTGCAGCAGTGCACACCCGATGGCGTAATTGGACGCATCGCAGACG
ACGCTAAACGGCTTCGTCTCGTCCGGCAGGGCCAGGGAAAGAGACCTCTGTGGGAGGCTGGCCCTGATGTCTGTCCAAAGCAATCTGGGTGCTCTGTCTC
CAGGCGCCAGTCCAAGTCCTTTCTGAAGGAAGACGACACAGGCCTAGCGAGGCCCCGTACCCTGCACTGTACTCGTGAAGATAGTTAGTCAAGCCCAACT
TTTCGAAGATTCTTCTGGAAATCGGGCGTTGGCCATGCTGCTATGTCCTGACCTTGTCTGGGTCAGCCCGAACGCCCACGTTTCTTACGAAGCAACCGAG
AACGTTAATCTCTGATGACGCGAAGACGCACTTGTCGATGTTGACGTAAAGCCTGCTCGCTCGCATCACGTCCAACACTCGACGGAGGTGCCCAGAAGCA
CCTCCATGGCCGTCTTGCGTCCCTCGGCACGGCTATGGACGAATATGTCGTCGAAGTACGTCTGTACGAAGGCGTGCAGTGGCCTGAACAATTGCGTCAC
GAGGCTATTGAATGCCGCCGGAGTGTTAGACAAGCCCTGCGGCATGACGAGCCACTCCCAAAGCATGCCGCTTGGAGTGCCCACCGCGGTGAGTGGGATG
TCGCTCTCGCGCATCAAGATCTAGTAGTATCCGTCTACCAAATCCAGCGCACTTTACTGTACGCTTTCTGCCATGTTGTTTAACAACACGTCCTTTCGTG
GGATTGGTGTTTGGGCCGGCACCATCGCGTTGTTCTGCTTGTTATAAGCATGAACTAGACGGCAATTTCCGTTCGGGCTCCGAACGCAGAAAGCTGGCAT
CGAGTGCGGGGACTTCGACTCCCGCACCATGCATGCCTTCGCTTTCGCAGCGAAGAAGGCATCAAGCCATTACCTCGTGACACAATACTTTGTGCCAGGC
ACGAGATCAATCTCATGCCGTACGTCTCGATCCGGTGGGAGTTGGGTCGGTGGATGTTTGCTCACCACGTCCGCATACTCCGATACCTATTGTTTCATTG
GATTCCTGGGGGTCCTTAAGATACTCAGAACCCAAGCGCGTCTGACGCTGCTTGCTCAAATCTTCTAGGACGTCCTCGTCCAAGACAGAGGAGTAGTTCA
ACTTCTCCCGAGTGGCATCTGGTCTAATGAGCACCATCTCGGCAATCTCCCCATCTCGGCAATCTCCTAGCGGCCGTCATTTCTTCGAGGTTCGGTATCT
CTGCAACCTCTGGCAACGGCGCCAAGTGGACACCTGATGCCTTGACGAGTAAGCCGGTCTCGCCATCGAAGATGCGATAACACTCTTCCACCGGCCTTGT
CGGAGGAGCCCGGGCACTGGACTCCGAGTCGCTTGAAGCGACGTCATCGTCGATGGGCGACCGTGACGTGGAGTTTTGCTACCCACGTCTGGGGATGTCG
GCGCTCCGACATCCGAGGCACTCGTGGCCTCGTGTGATACTGTGGTACCCACACAGGAAGCGTGCTCAACACCTTCCTCTTCAGTTAAGGTCTGGGCGAT
CGCGTGTGGCACTATGTTACCCACCCGGAACACGCTATCGTCAAAGTTCGTGATAGCTGCAGCTGTCTGCGGAACTAAGTTACCCGCTTGTGGACCCAAG
TTACCCACTTGGCCAGAGCCTCCTCTGGGCGCTGCCACCATCAAAACATCCTTGGAGTCGTCATATACGTCGATGACTCCCAAGCATCTGCCGGACGCTT
TGGTCCCCCGACAACCCTTGCGAGCGCCCTGGGTTCTGACAGAGGTGGGAACATGACTCACCAATGCTCTGTCGGGCTGCGCAGGGCGGCTGGCACCGAT
TGCCTTGCCTCGCCAGCCGATCCAGGGCTCGTGCTTCTCAGCCAGGGCATGACCAGGATCATATCGTATGGATCCATGTCGAGAACAGTGAACTCTTCGA
GGCTGTCAAATTCTTCAAGCTTGACATCCAGATCCACTTGGACGTTGGGGACAGTGACGACCTTCCCGTCAGCCGGTCGCTCTGATACTGTCCCGTTGCC
CTTGCTTCTCTCAAAACATCGGACAACTTGTTGCTATTACGAGCAACTGTCTGGCGGCGTGCGAAATTCCCTCGATGCCCCAGAATCGATCTAGATTCTG
AAGGGATGATCGTCTCCCCCGTACACATCCCGTGTACTACGAGCAACCCGCCGCTGCTCTTCACCGATTCGAGGGTGCGAATACTCTCAGGGGCTAAGTA
CCGTGGTATGCCGCCACCCGCGCACCCATCAAGAACGCACTATAGTCTCCCAGTATGCGCCCGCCCCTCCTCCTCTCACGTCCCCTGCCCCGAGATC