Description :
From Genome Similarity Track
Location :
Scaffold_841:1- 2579
Transcript NameFunction/comments
g17520.t1hypothetical protein

Sequence
2578 bases(100 bases per row)
TACATCTCGTCGATCATGCGCCGCATACCTCGCGGAGTAGCTCCCGGACGGATCTCCTCGTCCTCATCTGGATCACCGGCGGGTTGTCGATGAGCATGTC
ACGTGGAATCTTAATGTAGTCATTTCCCAGATCATTGTGTACCTCGTGTCTCCCCTCTCCAACCTTCAGCAGGTACTCGGAAAACGCAGCCATCTCAGCA
GCACTATCGGACGTGGCAGCCGTGCGAACACGCATGTTCTCTGTCAGACGCACCTTCTGGAAAAGTGGCCACCGTTCGGATGACTTCAGGCATGCGTCGA
TTGTCTCTGTCGCCGAGCCGCCCTTCACCACCGGGAGAATTTGCCTGAAATCTCCCGAAAGCACAACGACTTTCCCACCGAAAGGTTCTGCCTCGTTATC
CAAAACATCACGAAGCGTTCTATCCACTGCCTCAAACGCGTGCCGATGCGCCATGGGTGCCTCGTCCCAAACTATCAAACTTGCTTTCCTCATCAATTCC
GTGACCTGGGATCGCTTGTTGATGTTGCAAGTAGATTCGCCGTCTATCTTCAATGGGATTTTGAAGGTAGAATGCGCTGTCCGACCTCCCATAAGCAGCA
GAGAAGCAATCCCACTGGAAGCGACCGCGATTGCAATTTTTCCGGATAGACGAAGCTTGGCCAGTATGTTCCGAAGCAGTGTCGACTTCCCGGTACCGCC
TGGTCCATCAACGAAGAATAGCTTCCTGCCTTCCTGTGGGTCCTCGACAGCTTGGGTGATCTGATCATAGGTCAAGCGCTGCTCCTCGTTTAGGTGGTCC
TCCTCACTCACAATTTGTTCAAGAACAGACGCGTCATATCCCGTTAGCTCTCGTCGGATGAGATTGTTTTGCAGAACAGACTCAAGCACCAGGCGAGGGA
ACTCGCTCAGCCGAGGGAGATCAAAGTCTTGGACGGAGTATCCACTGACACTGAGCAAGTCTTGGATACTCTTCAGTGTGTCGAACGTCACAACAGACGT
TTTAAAAGGGTCCAACATCTCTCGGTTCCTGTACGCATAGTCAAGCGAAAGGTCTTTGAAGAATTGGTCCCAAAGACCCCTAACATCCGTAGGCGCCGAG
TAGACCAAGATTGTTGCAAAGAGCTGGCGCAGCTGGTACGGCATCTGGAACTCGGCAGCCTCCGACAAACACAAAACCCATTCGCTGTCGTTCTCCAGAT
AGCCGGCATGTTCAGCCGCGTCTCGATACGTGGGACACAGCACACCATCAACTGTCCGCAGGTCTTCGAAAGACCTCGGTCCTCGGCGATGGCATAATAG
CAGGCGTAAATAGAAGCGCTCCATATCACGCGGTGAAACATGCACCATCCGACCAATTGCAGCCTGGTACCTTTTACGTCGAACCCAGCACTTCGTGTTT
CCCATCCAGCGAAATTCCTTGGGTATATCCTGGTACAGCATTGTCTTCGCGATCTGGTTCTCGGGTTCGTCGCTCGCACACAATTCGAAGAAGCGGGTCA
ACATGGTGTGATTCCCACGACCAAGGACACGCTCCGGGTCTTCCGTCGCTCTGAAGAACACGGTTTGGGCATCTTCAACGTGAACGGTAAGCTGAGTGAC
TGCGTGTGTCTTTCCTTGGATCAAGAAGTCGAGTAAACGGATACAGGCTTCAACTGGAGATATGTACCTGGCCGTGAGGAAGCGCAGAATCTCGTTTGGC
TCTTGCCGAGGGAGCTCTCCACCCGCGCGAACTGCCTCGACAGTTAGCACAGCTTTATCGGACCCTTTGTAGACGTACTTGTATAGATATTTCACAGCTG
AAATATCCGTGCACACCTCGACGTTGATGTGGCAATTGTACTTTTGGGATAAGTACGGGTTGTACGGAACAACCCACTGGTTAATAGTGGCGTTGTCGTA
CTCCCTGCCCTTCCATACCAGGACGCCTTCAGCTCGTCGACGCCGTCTGTAGACCGGATAGCCGTTCACATTGGTCCTTGTCGCCTCTGCAAAAGGTTTC
GGATATCCTTTTGTACACTTCCCGTCCTTCATGCAAGCGCATGACGGGTTTGCCGCTCCACAGGGTCCATGCAGCATGCATGTCATGATTGTCTCGAATA
GCTGCGGGAACTTTTCTCTGTCAGGAAGCTCTGCAGACACCATACGATCTACGATTTGGCGAGTACGTGGCTTGTCCTCTTCAGCCAAAATGATCAAGAT
GTGCGCGTGAGGGAGCCCTCTCTTTTGAAACTCGACCACGTAAATCCGCGCTTCCATACGGCCCAGCACTCCTTCGCTCAGGTCTTTAAGCTGAGCTTGC
AGTTTTTGCTGCCAGACACGGGCTACAATATCGGGGCGGTCCTGAGCGTTTTGTTGATCGGACCCAAGGGCCTCGACTATCTCTTCCCATGTAGGGCTGC
AGGTCGTTGTCATGAACACATCAGGCTTGCCGAATTCTCTAACAATGGCCATTGAGTCTTGGTAGGACTGGTACATCGCTCGAGGACTGCCCATATGAGA
TGAGGGCAGAATAACGCGGCGTCCCACTTGGCTAAGAAAATGGGTATCACCACCACGGCCTCGATCAGGGTGGACCAA