Description :
From Genome Similarity Track
Location :
Scaffold_1234:1- 2573
Transcript NameFunction/comments
g15842.t1hypothetical protein
g15843.t1ETI30235.1 hypothetical protein F443_22644, partial [Phytophthora parasitica P1569

Sequence
2572 bases(100 bases per row)
GCGTTCTTCAGTCCCTGCGGCATCACGAGCCACTCCCAGAGCATGCCACTCGGAGTGCTTACCGCCGTGAGAGGGATATCACTCTCACGCATGAGGATCT
GATAGAACCCGTCTCTCAGATCAAGAGTACTGAAGATAGTACTCGAGGTCATCGAATCGATGATGACATCTTTTCGAGGTATCGGCGTCTGCGCCGGTAC
CGTCGCATCGCTCAGCTTGTTGTACGCATGGTTTCTTGACACAGAGCGTAGGCGCGCTGTGCGGGGACTTCGATTCCCGCACTTGTCCTGCATTGCGACG
GCTTTCAAAGATGTCGTCGATTGCCTTGACTTGCTCACGCGGCAGTGGCCACTGCCGCGTGACGCAGTACTTCGTTCCCGGCACGAGATCAATCTCGTGC
TGAACACCCTTATCCTGCGGTAATTCCGCAGGAATGTCGTCCGGGAGTACATCCTTGTACTCACGCAAGACCTTGTAAAAGGGGCTCGCCTTGAGCGAGT
CCCAGCCTTGCTCGTCGAAGCGTTCCTTGTTCGACTTCGCGCTGAGGGCGTCCGCGCCCTCAGAGATGAGCTGATTCAGCTCTTCTGTTTCACACGTCAT
CCTCTCGATGTCCGAGAGGATGCAGATCTACTTGATGCGTCCATCGTGCAGTTCGCGAACGAAACGCTTCCAGCTTGTGACTGGGAGCGACATCAACTCC
GACGCTAACGTCGGAGGATTCTCCAGCCTCATCTTCTTGTATTGGAGACCAATACTCGTACGCGTCAAGACATTCAATGTCTCGACGGTCGTCTCCAACT
CCTGTGTCTGCCCGGCAGACACTGCTTGTAGCGTCTCGGTCCCTGACTGAGACTTGCGCAGCTTTGATCGCTTACGCCGTTCACTTCTCGTGCGGAGCCC
GGCTCCGCGAGTTTCTTCTTGTCCAGGCCCGGCCGTGGACAGTTGTTCCTTGTATTCGCCGGCGGGTTTTACCCGCGGGCGCACGCGTTCAAGCCCGGCT
TGATCGCGCATCGCTTCGTCGTGCAGCCCGGCTGCACGCGAGGTCGCAAGCATTTCCGGTGCGGGACGTTTGCAACTGTCCGCACTGCTTGCAGCGTCGG
CTCTCAGAGCCGACGCGTCTTCTTTACCTCTACGCCTAACGGCGGAGTGTCTTTCGACCAATTGTGTGTCGACATTTCCTGTCGACACTACCGCGTCGCT
CCGGACGCTTCGAGACCCTCTCGAATCGGATTGAATCAGGCCCTGCTGATTCGTTTCACATCTTCTTCCAACGACTCTCGCAGTCATTGGCGTTCGCTTG
GGGTGATCGGAGACAGCCGCATTCCGCGCTGTCTTTGATGGAGGGCCGCATGCACCACGTGACGCATGTGCTGCGCCGACAGGGCCATCGCTCTCTGTCG
CGCTGCTGCTGCTCCCGAAGCGCACGATCGTGCGCTTCGTCCAGTCGATCACCGGATCATGCCGTGGCTTGCACGGCATGCCCAACACCATATCGAACTT
ATCGTCCAGTTCGAGGACGATAAGCTCGTCGACGAACTCCTGCTCTTGATAAGAGAAGCGTACGCGTATGATACGCTTTTCGGTTCTAACAACGACACCC
GTTGCTAGCCTCACTTCCAATAGACTTCGAGGTGTTTTCACCTTCTCGAAGTCAAGCCTAGGAAGGCTCTGCAGTCGAACAAAGTTGTTCAACGCACCAC
AGTCCACTAGAGCACGAAGAGACTTCTCTCTCTTCGAGCTTACCTTCAGGATGACAAGGTTCGGCTTGTCATCTTGCTTCTTGCAGTGAGATTGACTCTC
ACTGGGGGCAGCGATCTTCATTGCAGCGTGTCCGATGTCGACACGCTCGATCGCATCACCAGCAGGGCGCCCCGCGCCTGCTGGTCCCTTTAGTTTTTTT
GATTGCCCGTGACGATACCCAGTATCGCCACGACGGCTCCTCGCTGCGTGCACAGGTGCTGTGCACTCGCGGGCATAGTGACCGATGTTTCCGCAGCGGA
AACAACGCACATTCGTTGATCCACGACGCTGCTGGGGACCAGCAGCGGTCGCACTCGAGAGGTCCATTGGTTCGGGACCTCCCGACGGCCTTACCACCGG
TCGTGGCATCAGGCGTGGGGCGTTCACATGCAGTTTAGCCTGCCGCAGGCTAAACTCTTCTTGCATTGCAAGCGCAATTGCAGCCTCGAGAGTATTTGGA
TACTCTCGGGAGAGATAGGTCTTCACAGGCCCATCTCTAAGGCCCTTCATGAACGTGACGACCTTTGTCGCCTCGTCAATCGGGTTGGTCACGATGTTCG
AGACCAAGTACTGTGCTCTTTGGGCGTAAGCATGCACGTCATGCTTGCCCGTTGCAGATCGAGGAACTCCACCCTCGATCGGAACTCGTTCTGCGGGGGC
TCAAACGCTAGCTTGAGCTCCTCCTTGAACTCTTCGTACGTGCTAAAGCACGTACGGTCCGTGAGTCGGCGTCCGTACGCCCAACTCCTTGCTCGTCTGC
CAAGACATGACATGGCGAACGCAACCTTCGACAACGGGTCGACGATACGTTGAGCTGTAATGGCAGTGTCGA