Description :
From Genome Similarity Track
Location :
Scaffold_1936:1- 2549
Sequence
2548 bases(100 bases per row)
TTTGCATTGACTACAGGCTCATCAACGGGCTGACACAGTTGATGATTTACCCCATGCCGCTCGTCAACGACTTGCTCGAAGACTTGGACAAGTATCTGTG
GTACTGCTCCCTCGACATGGCGAGCGGCTTCTGGGTCGTCCCCATGACAGACCGGGCCCGGCTCACCTCAGCCTTCATCACGCCGATGGGACTGTACGAA
TGGCTGCGTATGCCGTTCGGGCTGTGCAACGCGCCGCAGATTTACCAACGCTTGATCGACAACGCGCTCTACGGGTTCATGATGCTGTCCCCGGATGACA
GCACTCGGGACGTCTTTGAAGACGGCGAACCGGTGAAGCCAGGTATTCACTCCGTTCTGGGTCGGAGGTCGTACATCAACGACATCCTCATCGGGGGTAC
GTCGTGGGACGACCTGTGCGAGAAGGTCGAACGCTTGCTGGATGTCTGCGAGCAGTGGTACTTGTCCATCAGTGTCGAGAAGAGCGAGTGGGGCATGTCC
AAGGTCGACTACCTGGGCCACCGAGTCTCAGGACTCGGTCTCGAGGCGAAGCCGAAGAATCTGGAGTCGCTGACGTCGCTCGAGTTCCCGCGCACGCTCA
AGGGCCTGCAATCGTTCTTGGGTAGCCTCAATTACTACCACCGGTTCATTGCAGACTTTGCGGTGTACGCAACCGCGCTGTATTCGCTGACGGAGACCGA
CTTCAGCGAGTACGTCACGCATCCAGAAGTCCGCGGACATGAGAAGTGGACGCACGCGACGCGCGCCTTCGACGCGCCCAAGGCAAAACTCGCCGAGACC
CCAATGTTGAAGCACTTCGACGCGAACCGAGAATCCGTCGTGATCGTGTACGCCAGCGACTGGGCCATCTCAGAGTGCTCACGCAGGTCCACGACGAAGT
GTACATGCCTGTGAAGTTCACCAGTCGTACGTTGAAGCCCAACGAGCTGAACTACGACATCGTCGAAAAGGAGATCTTGGCCCTGTTGCGCGTCTTAAAC
GAGTGCTACACGATGCTAGCAGGGAGACCGGTCCGCGTCTTGACACGTCACACGACACTCGCCTGGTTGTCCCGGTCCAAAGGACTACAGGGGCGACTGT
CACAGTGGGCCGCGATCCTCTCGCCGTGGAAGTTGGAAATCTGCCGATCCATGAAGGGAGAAGAAGAACTCCTCGGCGCGCTGGCCGCGAGCATTACCCC
GCGAGCCTTCGTCGACGCGGCGCTAGAAGAGATCGCCCCACGGAGACGGGCGTCCAGCATTGTAGTCATTCCAGTCCCCGACGTGGCGCGCGACGAGGTC
TTGCACGTTTTGAGCTTTGACGGATCGGCCAAGGCGAAGCGAGAAGGCGGAGCATACAGTGCCGTCATTTGGCAGCTGCCGAACTGGGAGATCGTGCGCG
CCGCGTCGGGATATGCGACGGACCTCACGGTCAACGGGAGCTCGACGACGTCACCCGACTCGTCGTATGCGGAGACTCCAACCTTGTCATCAGGCAGATG
CGGGACGAGATGGACTGCAAGTTCCCGGGGCTGAAGCTGCTGCGACAAAAGACGCGAAACGCACTCCAGGCATGGCCGCGCCACGAACTCTTCCACGTAG
GACGAGACTGGAACGCGAGTGCCGACATGCTAGCTGGACATGCTCTGCAGCGTCAAGGAGGCCACAACGCGCACAGCCCCGAAGAGATTCAAGATCTGAA
GACGCTGAATCGCTTGGAAGAACTCATCCGACCACGGGCATCGAGTCCCGGGATGGCGTCTCCAGCGAGTCCCGACGCGGATAATCTCGACGCAGAAAAC
CTGGACTCGGAAAATCGCGACGCGAAAACGCGCGGCGCAAATGACCCCGCCGGGAAGGCCATGGACGCGGGACGCGGGACAGCACAAGTCCGCGCTGTGA
CGACGCGCTCGGCTGCCGCACGCACGACAAAACGTAGGGTCCGACCTCCAGAAGTCCTGGAGGAGCTGGTGGTGCAACGACTGCGCCTGGACTGCATCCG
TGTCGCCCAGGACGAAGAGGTCTGGATCGTCAACCTCAATAAGTATCTCCGCGGCGACGTCGGAGACCTATCTCGGCGCGAGGTGAAGAACTGCCAAAAG
CTTGCGCCTCAGTACGAAGAGGGCGAAGGCGGGCTGCTCTACTACCAGCCGAGAAGCGACGATTCCGCCGAGGATCGCGATGTGATGATGAAGCTGGTGA
TCCTAGAGACTCTTCGGGAAGATGTACTCCACCACTGTCACGCGAGCCTGGAAGGCGGACACCAGGGTATTGGCCGCACGTACCAACGCGTAAGGCGCCA
CTTCCATTGGCCAGGGATCTTCAGAAGCGTCCAGCGCTACGTCGGCGAATGCACCGACTGCGAGACCGGAAAGGGTCGGCCGACCATCCAGGGCGAGTTG
CCGGGCAACATCGTCGCGACGTACCCGTTCCAGGTCATTGCCATGGACCATATTCCGTCGTTGCCGGCATCCTACAAAGGCAACACAGAGCTGTTAGTCT
GCGTCGACCTCTTCACGGGGTTCGTCGTGGTCAAAGCGAATGCAACAC