Description :
From Genome Similarity Track
Location :
Scaffold_2739:1- 2536
Transcript NameFunction/comments
Phyra_87829Hypothetical protein

Sequence
2535 bases(100 bases per row)
TCGATCGTGAGCAGTGTTGATCGCGAAAGTCAGGCGCTCCGCGTATTCGTCCCAGTCTTGTTGATTCACATCGGCGACATACATCTTCAAAGCGCGAGTA
AGCGTTTGCACCATCCGCTCAGCGGTACCGTTTGCTTGTGGTGGATAGGCCATGGTGGCTCGTTGTCGTTGTCCCACTATACGGCTGAATGCGCGGAAGA
AATCAGACATAAAACCGGGCTCCCGATCATGTCGGATCGCTTCACTGGCTCCGAAGCGGCGGAAAACGCATTCCTCGTAGTTCTCCGCGATGGTCTGTGC
TGTCCGAGACGCGCCGGCCTTAGCGATCACGTACCCTGAGAACAGATCGACCCACACGAGGAGCTCCGTGTTCCCCTTGAACGATTTTGGCAGCGATGGG
ATATGGTCCATCGCGATGATTTGGAAGGGGTAGGTGGCCCGTACATTCCCAGGTGATTCTCCTTGAACCACGGGGCGTCCCTTCCCTGTCTCGCAATCCA
CACATTCACCCACAAACTGCTGGACACTCTTGAACAGCCCCCGCCAGTGGAAGTGTGCTTTGATCCGTTGGTACGTCCTCCCGATTCTCTGGTGCCCTCC
TTCAAGGCTGGCGTGATAATGGTGAAGGAAATCTTTGTGTAACGTTGCAGGTACCACCAGACGCGCGATCGAATCTCGGTCCTCGTCTAATCGGGCGGTG
TTCACACAATAGAACAGCAGGCCGTCTTCCCCCACTTCGTAATCTCCAGCGATCTTGGCGCACGCTTTTGCATCTCGGGCAGTCAAGGCTGCCGCGTCGC
CCCGCAGGTACGACTTCAAGTCTACGATCCACTTCTCTTCATCCTGAGCTCGTACTAACCTCTCACCCCTCATGCGTTGGACGATCTCTTCTTGCATAGC
TGCCGGCACTTGACGGTGCCGTCGGGCTGATCGGGTCACTGCTGACACTTGAACGACGGGGTCGTCATTACTCGGGTGGAGCAACCCGCCCAGGTGGTTG
ATCGTGACGAGATCGCCAATTTCGCCCTCATCAGTTACGATCACGCCTGCTTCTCGTTGCAGTGCCGCACTTGCCAACCGATCGGCGCTCTGATTCCAAT
CGCGCTTCACATGGAGGAATTCGTGCTTCGGCCAGGCTTTCACTTGATCCATCGCTTTCTGACGTAGTATCTGGAGACCTGGTGCCTTGCAATCGATTTC
ACCACGCATCTGTCGGATGATCAGATTGGAATCTCCACAGATCATAACTCGCCCCCTGTCTGATCGGACAGTAGCTTGAAGCCTAGCAGAAGTCCGCGAT
ATTCGGCTTCGTTGACAGTCAGATCGTCGGCGAATTCGGATGCGGCAGATATGATCGACCACTCCGGGAGCTTCCAAACAATTGCACTATACGCTCCGGC
GCTCCGCTTGACGCGTGCTGACCCATCAAAACTGACGACGAGCAACTCTTCATCCAGCTCTACCGTCAGCGGGGCCATCGCGATCGTTCGTTTGGGCTCT
TTCACCGGTGCAATCGCGATCAAGGCCTCGTCCACTTCCGCTCGGGGTGTAATGCTGGCGGCGATTGCGCCCAGGATGTCGTCCTCTCCTTTCAAGCACT
TCCTGATTTCCAAGGTCCACTCGGACAGCAGAGCTGCCCATCGTCCTAATCGTCCCTGGAAGCCCGACGCATTCAGCAACCAGGCGAGCGTCGAATACCT
CGACAGCACCTTGATCGATCGGTTGGTCAGGAGTGTGTAACACACGTCCAAGATCCGGAGGAGCGCCAAAACTTCCTTGTCCACTATGCCGTAATTCAAT
TCGTTCGACTTCAGCGTACGACTGGTGAAGATCACAGGCCAATACATGCCATCATGTTCCTGAACCAACGCAGCTGAAATAGCCCACTTGTTGGCGTAGA
CCACGATCACAGGCTGGCGATCGGAATCGAAGTGTCGCAAAATCGGGGTGGTCGCAAGCTTGGCCTTCAGTAGGTCGAACGCCGTCCTCGCTCTAGTCCA
CCGATCGTCGGACTCCGCCGCTCGGTCCTCATGCTTCCCGTGGTGCATCTCGTAGAAGTCCACTTCTCGCAGTTCGTATAAGATCGCGGCGTAAACGGCG
AAGTCTTCAATGAAGCGACTGTAATAATTCAGGCTTCCTAAGAAGGACTGCATCGATCGCAACGTCTTCGGAAACGGCAGCTTCTCCAGCGATTCCAGAT
CTTTCGGATTGGCTTCCAAACCATCGGCTGATACCCGATGACCCAAGTACTCTACCTTCTGATGTCCCCAGAAACTCTTGACCACGCTGATCGACAGGTT
CCATCGCTCGCAAGCGTCAAGCAGTGCCTCGACCTTCTCGCAGATCGAGTCCCAGGTGTCAGCGATGATCAGGATATCGTCGATGTACGATCGCCTGCCC
AGCACCGAAGGTCCCGGGTTTGCCTCGGGTTTCCATTTCTCGAACACGTCGGTTGGTTCCGCGTGGTCTCGATCAGGACTTATCCGGAGGTATCCGTACA
GAGCATTATCGATCAGCCTCTGGTAGATTTGTGGG