Description :
From Genome Similarity Track
Location :
Scaffold_3490:1- 2532
Sequence
2530 bases(100 bases per row)
TCTTAGAGCTTCTCGTCGCTCCTCGCGGGCTTGTGGGCGGACACACTTCTAGGGGCATCTACGAACGTGCCCTTGTTCGGAAAGAACAGTTGTTTGTTAA
CAACATGGAGGCTGCTCGGTGTGTGTTTCTCGCGCCGCACCGCCTCCCTCTCTTGGGGGTCCCCACTTGTCGTAAGAAAACCGAGACCCCGCGGGGGCTC
TCTTCTCTCTTGGGGGCCCCGTGGAGATCTCTGTGAGGGCATGGTTCTGGGCATGGGTGGAGACTCTTAAGTACTCACCCACGGAGTTACGGGAACTCCA
TGAAGATCAGCTGCTGTCCCGCATCCTGGACCAGCGTAATCTTCGTGTGAGGTTTGCCCACTTGATCAGCAAGCGCATGCTGCCAAGGGACATCCTGAAG
CGCGCGGCTTCTAGCGCTCACGATGAGCGCGGGTACGGAATGTATTCATCGTCCGTACCCCGTTCGGGCAAGAAGACCCGGACTACTTATGGAGCTGCCG
CCGCTTCTGTTCCCAGATTGCGACAGCCTTTGGTCAGTCAATCAGGAGCCGTTCAATCGGCTCCTACGAGTTCTCGGAGTGGGCATAACCCCTCCACTTC
ACGAGGAGCTGTCGCTTACCGCGACGCCGTTGCTCCTGGAGGATCCGCTCCACGTGGAAGTGGACCTCTCCATTCCAGTCAAGCAGGGGCGGAGGTGCCC
TCGTACGAGTACGAGTACTCGGCGCCTCCCGAAAGCCACTCTCGTCCGAGTGCTCCGACTGCGGGTCCGACACAGGGCCCTGAGGTTGACCGCCTCCGTC
AACGTGTCCTCGTGCTTGAGATTGCACTTGGCCTTGGGACTGGCGGTGATTCTGCCGCCCAGGTCGGGAATCAGGGCGAGCTCGCTCGCCTTGCGGGTCG
CCTGGACCTGTTGGAGCGAGAGGTCGCGAGCCTGCACCTGCGGGTGGATCGCCGGGTCTCTTCGTCCGATCTGGACGAGGCCTTTCGCATGATCCGACAG
ATCGAGGATCTGTTGCCACGTCCGGATCCGCCTGCGGCACAGTCCCAGACGTACGCGTATGGTGCGTACCCGGCGTACTCAGCGTACTCGGCGTATGGTT
CCGGGGTCCGTTCGTACGGAGTTCCTCCGGCGTACGGTCTTGACCGCAGCCTTGCCGTTCCGACCGAGGCTTGGGTGCCTGCCTCCGACGCCTTCGTCGA
CGTCTGTGGACCGCCCTCGCTTTGAGGAGCTGGGCTAGGGTGGGTCTGCGAGTCAGCAACCACCTGCGGATCAAAGTACCGCTTAAGACGTCCAACATAG
AACGTCGAGTGTGTCGTCATTGACTTTGGCAGGTCGATGGTGTACGACGCACCATGTCTGACCAGGACTGCAAATGGTCCGATGAAGCCGGTGCTTCAGC
TTGTTGCTGCCGACAGAGCTGACAGTGTCTAGAGGTAGGTTCCTCGTGTCTAGTAACACTAAGTCCCCCACTTTGAATACACTTAAGTTTCCTCTTCCAT
GTTTGTCTGAGTACTCCTTTTGTCTATCCTGGGCCGCTGCCATGGCATCGCGGACCCTGCTGACAGCTCAGCTTGGTATCCATAAAGGATTCCACCGTTT
CCGCAGCGAAACTGGGTCTCACATCCGAGACCTGGGAAGGAAAGGGCTTTCCGAGCCTCTCCCCCACTTAGAATAGAGGAGTCAGTGTCTCCTCGAAGAG
TGAGAGGCACTCTGGGGTGGCGGAAGCCGTTCAAGTAGAGCGGCGTGAGCCCCGTGGACGCGTGCACCGCGTTGTTGAGCGCAAATTCAACAACTGGGAG
CTGCGTCGACCCACGTACGTGGTGCTGCCGCGCACACACTGCGCAGAGTGTCCTCGAGCACTCGATTGACGCGCTCTGTCTGGCCGTCTGTCTGCGTCTG
GCCCGCAGTGGACATCGCGGACGATTTACCATTAAGAGGAAGCATGTTTTTCCCAAAAGCGCCAGACAGGAAAACGGCGCGGTTTGTGCGTTGCGAACAC
ATTGTTCTGCCGGAGAAACTGTGATTGAGCGGAAACAACACCCTGGAGCAAACAACTCTGGGCGTTTGTTGCGCCCTTAGACATGAGCGAGAAGTGGAGA
CACACCATTTTTTTTTTTCAGCCGACACACGAACACAAAAATTCCGGTGTTGCCGTGTCCGTCGGCGGGAAGCCCAAAGATGAAGTCAAGACTCATCGAC
TTCCAACAGTCAGCCGGTACGAGCAGGCTCTGTAGTGGAGCCGAAGGGTGCCCTGTGGGTTTGACCCGCTAGCATGTTTCGCATGTCTTAACGTACCGGG
CGACCCACTTGTACATGTGGGTCCACCAGAAGGACTGAGAGACCGACAGAACGGTCCTCTCGCGGCCCAAGTGGCCGCTGGAGGGCGCGTCATGCGCCTC
CGCGAGGATGTCGAACTTCAGATCCTCGTCGTTGGGTACGACCACCCGTGGAGGATCAGTGGGCTCCACCCGATAATAGAGGAGGCCCTCCTTCAACTCA
TATCGGTGGAGCCGTGAGCGCTGTCGCGAC