Description :
From Genome Similarity Track
Location :
Scaffold_1729:1- 2531
Transcript NameFunction/comments
Phymu_g13590hypothetical protein PHYSODRAFT_325775

Sequence
2529 bases(100 bases per row)
TCAAGATCACCTCTAGAAGGAGGCGGTCAAGCAACGTATTGGAACATATTGGAACTACATTGGCCTTTAGTGAACACACCCTAGGACACCCCAGTAGATC
TTCGCGATGCCAAGATCTACACCCTAACAACTGCGAGTGAAGAGTTACCGCGAGCAGTCAAGCCGAGACCCAAGTGCCGTCCACACATACTCAACCAAGA
TCAAACCCGACATCTTCCCGAGtcacccaagaagagcgtaATCGTCCAACCCGACGGGTACACGAggtgagaagatcttcagaGCCCCCCACGGCAAGCG
GAGTACCCCCTCCGTCAGTCGGGAGtccggacgccaagtgtGTGAGTGCCcctcgcgtcgagtttccTCGCGAGCCACTACGCCACAATGGTGCGCGTGC
CCGGATCTTCTGGTGACTCCGGATATCACCGTGAGTCCAGCCAGGAAGATGTCAAAATCAAAGTTGAGCCAGGAACCGGCGCGTCGACGGAAGGTGAATC
GCCGTCGTCGCATCTGAAGAGTGAAGGATATACCGCACGCCAGAGTACTGGGAGGAACTCTGGCGAGGAACAGGAGGTTGGTTCTGCGATGGACCTGGAA
GAGTAGCCACCCCTCCTCCCTTGGGCCCTTCGCCCCCCCCCGCGGATCGCGATTCGAATCGCGATCCGCCGGATGAAGATCCATCCGTGAAAATGGAAGG
AACTTCACCCACAACCACTCCCCCCACACCCCGCACCtccgtgaagacgaagttggCGCCGAAGATGAGGGCTCCGGATGCGGAGGAGAGTGGAGAAGTC
AGGACCTGGACTCCGGATCAGTTACAGAAGATCTTCTGtcggaagcagctcaacgccTTTCTTCTGGAAGGTCCCGTGATGATAGTgatgaagccgaaga
tgATCGGAGAACTCCAAGGCCCTGTGACCTCCCCGGTCAAAGCATCCGATCTCATGGTCGCGATCACGAGCCTGATGAACATGTTGGAAGAGGCTGGgat
cgtcgctggagcaTTCGATGCAGAAACGTTGTTTGAGCTCAGCCTGGCCACCGTCGACGAGTCGTCCAGACGCCTGTTCAAGTTGCTTAGGCCGTTGGCG
GGCGCGATTTCGACATTATCGAGTCTTGGCCCGACAGAGGAGTACCCCACCTCTGCATCCTCGCACTCAGGATTCGCGTCTGCGAAGGCGTCTGTTTCCT
CGGATGCCGAGTCGGACGGCATGATCCAACCAGCAAGAATGACACTTGGTCCGTCCGGCGCTGCCATGCTCCAATcgaggaagatcaaggaggagaaagt
gCCAGTCAGCACTAGAGCGACGCCTAGGACGACGCCCGATCTCCACAGCCCCGATCGCATGCAAGTGTTCTTCAACACGGCCATGGAACGCTTCTTGAAA
GAGCAAGCCGTGGGGACGACCACCAGCCAGTCCAAGCCACCGACGCCAGGAATGCaggacgtcgacatggaaTCAGTGGAGTCGCTGCATGGGTCCCCAG
ATGAATACGACCCCGACGATTTGATCATAGACGCCCCACGCCGAGCTGTAGTAGCTTCGGCGGAGACAGCCACATCATCGTCGGAGAGCGCGTCAGCAAT
TCCCCGTGTCAGGATGTCAGCCATTTCTGAGCTGAAGGTGTTCTCCGGCAGAGACACCGACGAAGATCGTGCTCGAAGCTGGCTGGGCAAAGTGAAGCCC
GCGTTCGTCCGCGACCAGGCCCCCGACAGCGAGAAATGCATCGTATTTGGGAACCTGCTGACTGGCCCTGCGCGGAACTGGTACCAGCAACTGGGAAGAT
CAACCCGTGGCAAATGGAAAGATCTCTTGGATGGCTTCAGAGTCGAATACTGTGGGCTGGGCGTTTCCCTTGCGAGGCAGTACTACCacgcgaggaagag
atcTGACGAGTCGCCACTCGAATATCTCCACCGCCTGACCGTGTTAGGGCTCCGAGCCAAGTTGCCGATCAAGACTGGACCGTCATCCGCTATCCGAGAG
CATGTGGAACATTTCATCGAGACCTTGGACGATCGTGATCTGGCAGACCAgttgacgttgctgcgcCTTGCAGATGGGGACGCGCTGGCAGACGTGCTGC
GTATACGTCAGCGCGCGAAAGCCCGGCAAGGCAAGGCGGCCGCCGGATCAACCAAGTATCGCCAGAAGACTCCATCGGCGCCTCCCCAAGCTTTATCCAA
ACATGCCCGAGCTGTACGCGCGATCCGCATGACGAACGATAACGATAGTTCTGGTTCAGAGTCAGACTCCGGAGGATCGGACCTGGAACAAGGCCGATCC
CAAGTCTAcctcgctgctgtagcgGATCAACGGAAGCCGGAAGATCAATCTCAGCAACGCCGCGATCCCCAGGGACCGCCTACCAAACCGGATCAGCCCC
CTCGTCCTCGGACCGAAGAGCGAGTGGAGAAGTGTTCCCACTGCGGGTCCACGAAACACTCCGATCTCGGGTGCTGGAAGCGTCTGACGTGTCAGAagtg
tggaagaagaggccaTCCTGGTGATCATT