Description :
From Genome Similarity Track
Location :
Scaffold_3522:1- 2521
Sequence
2520 bases(100 bases per row)
ATCCTGGACCAGCGTGATCTTCGTGTGAGGTTTGCCCACTTGATCAGCAAGCGTATGCTGCCAAGGGACATCCTGAAGCGCGCGGCTTCTAGCGCTCACG
ATGAGCGCGGGTACGGTATGTATTCATCATCCGTACCCCGTTCGGGCAAGAAGCCCCGGACTACTTATGAAGCTGCCGCCGCTTCTGTTCCCAGATTGCG
ACAGCCTTCGGGCAGTCAATCAGGAGCCGTTCAATCGGCTCCCACGAGTTCTCGGAGTGGGCATAACCCCTCCACTTCACGAGGAGCTGTCGCTTCCCGC
GACACCGTTGCTCCTGGAGGATCCGCTCCACGTGGAAGTGGACTTCTCCATTCCGGTCAAGCAGGGGCGGAGGCGCCCTCGTACGAGTACGAGTACTCGG
CGCCTCCCGAGAGCCACTCTCGTTCGAGTGCTCCGACTGCGGGTCCGACACGGGACCCTGAGGTTGACCGCCTCCGTCAACGTGTCCTCGTGCTTGAGAT
TGCACTTGGCCTTGGGACTGGCGGTAATGCTGCCGCCCAGGCCGGGAATCAGGGCGAGCTCGCTCGTCTTGCGGGTCGCCTGGACCTGGTGGAGCGAGAG
GTCGCGAGCCTGCACCTGCGGGTGGACCGCCGGGCCTCTTCGTCCGATCTGGACGAGGCCTTTCGCATGATCCGACGGATCGAGGCTTTGTTGCCACGTC
CGGAGCCGCCTGCGGCACACTCCCAGACGTACGCGTATGGTGCGTACCCGGCGTACTCAGCGTACTCGGCGTATGGCGCCGGGGTCCGATCGTATGGAGC
CCCTCCGGCGTACGGTCTTGACCGCAGCCTTGCCGTCCCGACCGAGGCTTGGGTGCCTGCTCCGACGCCCTCGTCGACGACTGTGACCGGCCCTCGCTTC
GAGGAGCTGGGTCAAGGGGGGTCTGCGAGTCAGCAACCCCCTGCGGGTCAAAGTACCGCTTAAGACGTCCGACATAGAACGTCGGGTGCGTCGTCATTGA
CTTTGGAAGGTCGATGGTGTACGACGCACCATGTCTGGCCAGGACTGCAAAAGGTCCGATGAAGCGGTGCTTCAGCTTGTTGCTGCCGACAGAGCTGACA
GTGTCTAGCGGTAGGTTCCTCGTGTCTAATAGCACTAAGTCCCCCACTTTAAATACACTTAAGTTTCCTCTTCCATGTTTGTCTGAGTACTCCTTTTGTC
TATCCTGGGCCGCTGCCATGGCATCGCGGACCCTGCTGACAACGCTCAGCTTAATATCCATAAAGGATTGCACTTGTTTCCGCAGCGAAACTGGTCTCAC
ATCCGAGACCTGGGAGAAAAGGGCTTTCCGAGCCTCTCCCCACTTAGAATAGAGGAGTCAGTGTTTCCTCGAAGAGTGAGAGGCACTCTGGGGTGACGGG
AGCCGTTCAAGTAGAACGGCGTGAACCCCGTGGACGCGTGCACCGCGTTGTTGAGCGCAAGCTCAACGACTGGAAGCTGCGTCGAACACGTACGTGGTGC
TGCCGCGCACACACTGCGCAGAGTGTCCTCGAGCACTCAATTGACGCGTTCTGTCTGACCGTCTGTCTGCGGATGGTCTGCAGTGGACATCTGCAGACGA
GTTCCCAGTAAAGGGAACAGAGTTTTCCAAATCGCAGCAGTGAACCGCGGGTCTCGGTCCGAGACAATCGTCTCCGGGAGATCGTGATAGCGGAGCACGC
CATCGACGAACAACCTTGCGGTTTGTTCGCCCGTAATAGTGACGGGAACCGGAGCAAGATGTACCATCTTGCTCAGCCGACACACGAACACCAAAATTCC
GGTGTTGCCGTGTCCGTCGGCGGGAAGCCCAAAGATGAAGTCAAGACTCATCGACTTCCCAACGGTCAGCCGGTACGGGCAGGCTCTGTAGTGGAGCCCG
AAGAGTGCCCTGCGGGTTTGACCCGCTGACATGTTTCACATGTCTTGACGTATCGGGCGACCCACTTGTACATGTGGATCCACCAGAAGGACTGAGAGAC
CGACAGAAAGGTCTTCTCGCGGCCCAAGTGGCCGCTGGAGGGCGCGTCATGCGCCTCCGCGAGGATGATGAACTTCAGATCCTCGTCGTTTGGTACGACC
ACCCGTGGAGGATCAGTGGGCTCCACCCGATAATAGAGGAGGCCCTCCTTCAACTCATATCGGTGGAGCCGTGAGCGCTGTCGCGACGAGAGCCAGTCGG
ACTTCGCGCTCGTTCCGGCCTTAAGGAACTTGACAATAGGCGCGACAGCCTCATTGTCCCGATACGCCATGCGTATCCGATCATATAGATCCGATGTCAC
CCGCGTGATGTGGGCCAACTCATAGTCAAGACGCCGAGAGAGGGCGTCCGCAAGCACGTTGAGCTTGCCCGGCTTGTATTCGACGCGGAAGTTGTATTCC
GCGAAGAAGGACAGCCACCTCGCCATCCTTTGGGAGGGGTGAGGCGCGTTAGTCGCCGTCCTCAAGGACGCGTGGTCTGTGTAGATTACAAAGGGCCTAG
AGCCCAGAAGGTGAACACGG