Description :
From Genome Similarity Track
Location :
Scaffold_2690:1- 2479
Transcript NameFunction/comments
Phyag_g12709Avr4-associated TDF-like protein
Phyag_g12710hypothetical protein PHYSODRAFT_258180

Sequence
2478 bases(100 bases per row)
GCCATGAATGTCGGGAACGCCTCCAAATTGGCCTCAGGGATCTCCCACGCGTGCTTGGATCCCGACGACAGAGTAATGTCAGTGCGCACAGTCTCCATTA
CCACCGACGTCTGTATGTCCTCGGACAGGATCCAGTTCATGAACAATTTGGCAGTCGCTGGGTTCTTCGCCTTTTGGAGGATAGCAAGGCGCTGACCCCA
CGTCAGGTACTCGGTGCCGTTGCCGCCCACGTACACGACCGGAGAGGCGCCAGCGTAGGTGCCCACGCCAATGACCTTGTCTTGGGCCGTGACCAGGTTG
TTGGCGACGTGCGAGCCGCGGTTGAAGCTGATGCTCTGGTTGGCCATGGCGGCAACCCAGTCCCAGCCGTACTGCTCCACATAAAGGTGGTAGACAAACA
AGaccgcgtcgtcgtcgtgagGGTACGAGGATGCAATCTTGCCGGCCCACTGGGAGCCAGTGAGGTCGGCCGGCGACGTGGGCGCATCCAGACCGCCGAG
GTTGCTCGAGTCGTAGATGTAGCTGAAAGAGTTCACACCGTACGCAAACCAAGCACCATTCTCGTCTCTGAGGGTGTCGTAGATCTTGGAAAAGTTGGCG
GGCTTGTACTCGAGCAGGTCGCCGGCCTTGGCCCAGCGAGGGAAGTTCTGCACAGTCTGGAGTGCCGTGATGTCGGGCACGAGCGTGTCAGTTTCGAGCT
GGTTGTCGATACGCACGTCGTGGTACTTGCTGTAGTCCACAACCATGGTCACATTGATTCCGGGGAAGGCGTCCTCGAACGCAGCTTTCAGCGAGTCTTG
CTGCGTCACGAAGTCTCCGCCGTGGTAGAAAATGAGCTTGCCACCTTCAGCGATGGCATCCGCGTACAGTTCATCGAGGGActtggtttcttcttcaaca
gcgATGGCGCCAGCGGTTAGGAGCGCGAATACTGCGGCGACAGGTGAgaagaacttcatcgttgcaggcgctggagactGGATCGGTGACGTGCAAAATT
GAAAATGAACTGAAGGCCGACGCGATCTCagatgagcagcagcttgctccTCTGCGCGGGTCTGCGGTGGCGACTACCGCATTGCCATCTTAATTCGTTG
AACTCCCACGGAGCTGCCCTTTAGATCTGCAGCTGGATCCTGCGAAGGCATAATACCTGACAAGATGTCGGGCAATACCCGCTGAAGGATAGTCTAGGCA
ATTCATGTGTACTTTGTCGCCTGGTTTTGAGTGAATTGAGTGAACGACAAGCCTTGACGATCTGTTGTTCGTGCAGGTCCCGTGCTTACCTTTGTGTGAC
GTGACACCCAACAGCGACCCCTTTCAACGAGATTGCAAGGTTTTGTATGATCGAAAAACCAATTCGCTACCGAATCAAAGCGCCTTTACGGAGTGCTGGC
TAAAAGCCCATTCGTGGATGGGCTATCGACTGCAAGTGCAGTGTACGATATCCGTGGAGGTGCTTACTCAGATCATCTTAGTGTTGTCATCCGATAGCGT
GAATCACACCGTCCGTTTCCGAATATCGCGTGACGATCACCTTTGATTTGCATCACCTGTGACTGGTAAAAACAAGAACACCGAAGCTTGCAATTGTACA
TCGCATTGAAGCGGTTAAACCCCTTTTCAGCGATCGATGGCTAGGCTATTACCTACTGCTGGCCAGGGTGCAGGCCAAGCCATCCAGGGCTGGGCTTGCC
CTGCACCTCACCAAAGTAAAGAGCGAACGTCTGCTTCCACTCCTCCACCTTGGCTCGGTCCTCCATGAACGGCGGGAAGGCAGCCATGTTGGCCTCCGGA
ACGTCCCAGGGCTTGTTAGCGTTGATATCGGTACGCACACTGTTGGACACCACCGTAGTCTGCGCCTCCTTAGAAACGGCCCAGTTCATGAACAGCTTGG
CGGCAGCGGGGTGCTTGGCCTTCGCAAGGATGCCAACGCGCTGGCCCCAGCTCAAGTAGTCCGTTCCATTGCCTCCCACAAAATCAAGAGACCCACTGCC
GCTGGTTCCCACACCAATCAACTTGTCGCCGGATTTCACAAGATCCCCCGCGACATTCGAGCCGCGGTTGAAGTCGATGTTTTGTTGCCCGACCTTGGTC
ACCCAGTCCCAGCCGTACTTCTCGACATAGCGGGTGTATAGGAACAacacagcgtcgtcgtcatgagGGTAGGAAGAAGCGATCTTGCCAGCGTACTGTG
AGTCCACCAAATCGGCCGGAGTCGTAGGCGCCGCCAAACCGTTGAGTGCGCTGGAGTTGTAGACGTACCCGAATGTGAAGATCGTGTACGCAACCCACGC
ACCGTTCTTGTCTTTCAGGGAGTTGTGGATCTTGGAGAAGTCCTTGGGTTTGTAAGGGAGGAGATCACCGGCCTCCGCCCAACGGGTGAagtcctgcagc
gtctgcaacgcCACTACGTCGGGTACCAGGGTCTCGGTTTCCAACTGGTTGTCGATGCGCACGTCGTGGTACTTGCTG