Description :
From Genome Similarity Track
Location :
Scaffold_1954:1- 2455
Transcript NameFunction/comments
Physo_126929gag protein
Physo_126930hypothetical protein

Sequence
2454 bases(100 bases per row)
TAGATTAATCTATACTCGGAGGCCCGAGTATAATTAACTCTAATTTAAACTAAGCTACGCTTCCTCACATACACGCGCACACGTGTAAGCTAAAGTAGTG
AGCCAAAGTAGGCCCATTGCACCTGGTAGCACTTCGTAGTCCGTCCAACGACCGACTACCTGAGTTCGTACGTCACCGCACGAACGCGGAGCTGAGAACC
TTCCCATCGATACGGAGGTGTCCATGGAAAGCTCCACTACGCCTGCAACTCACGTTGCACGCGCTGACTGTCCCCACCTGTCGGACCCAGAGTGGGAAGC
TCTCCAACGACTGTCAACAGTCATTGGTGAGGCGGCTGTAGCTACGATGCTGCGTACGCTAACGCCGACAGAGCAACATGGTGTTGCTCTGGGATTCATC
ATGAGGGAGCAGCGAGATGCTGCTTCGTCTACCACGGTGTCGTCCCCGACGACACCGCGCGCGCAATCGCTGAAGCTCAGCGTGAGCAATTTCGTTGGAA
GAGAGGGCGGGCCTCTTCTCCGTTGGCTTGTCGAACTCGACACTGCCATTGCGGCTCGACGCATCGTCGACCCGTTGTCGAAGGTCACGTTCGCCATGTC
ATGTCTTGGCGGACGTGCAAGAAGTTGGGCGTATGGACGCCGACTCTCGGATCCTACGTGCTTTAGCATGTACGAGGGTTTCAAGGAAGAGCTCAGACAA
GCGTTTGAGCCACCGCAAAACCAGTTCCGGTCGAGGGCGGGGTTCCTCGACCTGCAGCAGGGCAAGCATGATGTCCATGCTTACGCTCAGAGAGCACGGT
ACTTGGTCTCGAACATCGTGACCAATCCGATCGACGAGGCGACCAAGGTCGTCACGTTCATGAAGGGGCTGAGAGATGGGCCTGTGAAGACCTATCTCTT
CCGTGAGTACCCGAGTACTCTCGAAGCTGCAATTACTCTTGCAATGCAGGAGGAGTTTAGCCTGCGGCAGGCTAAGCTGCATGCACATGCGCCGAGGCCA
CAGCCACGCCCGGTAGTGAGGACGGGAGGCCCATTACCCATGGACCTCTCGTGTGCTGCAACTGTTGGACCCCAGCAGTCGCAGGGAAACAATGTGCGAT
GCTACCGTTGTGGTAGAATCGGTCACTTTGCTCGGGAGTGCACGGCCCCCGTGCACCAGCAGGGTGGCTATCGCGGCGGTGCCGGGCACCGTCGCAACCA
AACAAAAAACGCTGGACGCCAGTAGGCGCGGGGCGCCCTACTGGTAATGCAGTTCCGCGTGTCGACCTTGGACACGCGACACTGAGGACTGCAGCCCCCA
GTGAGGTTCATTCTCACTGCAAGAACCAAGATGACAAGCCTGACCTTGTCATCCTGAATGTGAACTCGATGAGAGCAAGCGGCTCTCTCCGTGCTTTGGT
AGATTCTGGCGCGTCGAAGAACTTTGTTTGACTGCGAAGTCTATCAAGGCTTGACTTCGAGGATTTAAAGATACCTCGAAGTATGTTGGAAGTACGACTG
GCAACGGGTGCCATCGTGAAGACCGAAAAGCGCATGGTACGCGTGCGCTACCCGTATGAAGATCAAGAGTTTGTCGAGACCTTTATCGTCCTGGATCTAG
ACGATAAGTTTGACATTGTATTGGGCATGCCGTGGCTTGCACGACATGATCCGGTCATCGATTGGGAGAAGCGCACTCTCGTGCGCTTCGGTCGCGACAG
CGGAACAGTGAGCGATGGCCCTGTTGCCGCTACGCACGCACCGACAGGTGCGCGCGACTCCCCACTCGAGACAGCGCCTAATGCCGCTGTCCCGGAACGC
CCTGGGCGCGCGCGAGCACGCAAGAGCAGCAAGCGTCGGCGTCGCCGCCGACGGCTGAAGGAGAAAATGTGTTGATCTCGGAGATCGACACCCGCTTTTC
AGCGAATCAGGAAGAGTCTCCGACCTCAAGGGGCACGGATGACGCAGACGAGTCACACGCCTCAGCCGTGGAGGCTGACGCGAATCTGATTGGATCAGGT
CCTGGCCAATAATAAGAGCCAAGGTGACGTAACGCCGTCGACTCCGGGAGTCGATGGCTTTGGTGAATTTGATTCGTCGGCTCGGGGAGCCAACGCACCC
TCCCTAATGGGGGTCTCCGCCAATAACAGGCGTCGAGGTAAAGATGGCGTGTCGGCTCCGGGAGCCGACGCTGCAGGCGGTGCGGACGGTTGCAAACGTC
CCGCACCGGAAAAACTTGCATGCTGTCGTGCAGCCGGGCTGCACGACGAAGCGCCGGGTGACCAAGCCGGGCTTGAAGTCGCTCGCCCGCGGGATGAACC
CGCCGGCGGCACTAAAGAAGAACACCCGTCCACGGCTGGGCCTGGACGAGGTCAAGAACCAAGCGGAGCCGGGCTCCGCAAAACAAGAAGTCGGCGCATG
CGAAGGTCGCTGCGCAAGTCTCGGCCTGGGTCCGAGACGCTACAAGGAATGTCT