Description :
From Genome Similarity Track
Location :
Scaffold_3534:1- 2445
Sequence
2444 bases(100 bases per row)
GGAACAGGTGGAATCCTTTATGGATACCAAGCTGAACATTGTCAGCAGGGTCCGCGATGCCATGGCAGCGGCCCAGGATAGACAAAAGGAGTACTCAGAC
AAACATGGAAGAGGAAACTTAAGTGTATTTAAAGTGGGGGACTTAGTGCTATTAGACACGAGGAACCTACCGCTAGACACTGTCAGCTCTGTCGGCAGCA
ACAAGCTGAAGCACCGCTTCATCGGACCTTTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCATCGACCTTCCAAAGTCAATGACGACGCACCCGAC
GTTCTATGTCGGACGTCTTAAGCGGTACTTTGACCCGCAGGGGGTTGCTGACTCGCAGACCCCCCTTGACCCAGCTCCTCGAAGCGAGGGCCGGTCACAG
TCGTCGACGAGGGCGTCGGAGCAGGCACCCAAGCCTCGGTCGGGACGGCAAGGCTGCGGTCAAGACCGTACGCCGGAGGGGCTCCATACGAACGGACCCC
GGCGCCATACGCCGAGTACGCTGAGTACGCCGGGTACGCACCATACGCGTACGTCTGGGAGTGTGCCGCAGGCGGCTCCGGACGTGGCAACAAAGCCTCG
ATCCGTCGGATCATGCGAAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGGTCCACCCGCAGGTGCAGGCTCGCGACCTCTCGCTCCACCAGGTCCA
GGCGACCCGCAAGACGAGCGAGCTCGCCCTGATTCCCGGCCTGGGCGGCAGCATTACCGCCAGTCCCAAGGCCAAGTGCAATCTCAAGCACGAGGAGACG
TTGACGGAGTCGGGTCAACCTCAGGGTCCCGTGTCGGACCCGCAGTCGGAGCACTCGAACGAGAGTGGCTCTCGGGAGGCGCCGAGTACTCGTACTCGTA
CGAGGGCACCTCCGCCCCTGCTTGACCGGAATGGAGAAGTCCACTTCCACGTGGAGCGGATCCTCCAGGAGCAACGGTGTCGCGGGAAGCGACAGCTCCT
CGTGAAATGGAGGGGTTATGCCCACTCCGAGAACTCGTGGGAGCCGATTGAACGGCTCCTGATTGACTGCCCGAAGGCTGTCGCAATCTGGGAACAGAAG
CGGCGGCAGCTTCATAAGTAGTCCGGGGCTTCTTGCCCGAACGGGGTACGGATGATGAATACATACCGTACCCGCGCTCATCGTGAGCGCTAGAAGCCGC
GCGCTTCAGGATGTCCCTTGGCAGCATACGCTTGCTGACCAAGTGGGCAAACCTCACACGAAGATCACGCTGGTCCAGGATGTGGGACAGCTGCTGATCT
TCATGGAGTTCCCGTAACTCCGTGGGCGAGTACTTGAGAGTCTCCACCCACGCCCAGAACATGTCCTCACAAGAACTCCATGTGGGACAGTTCTCGGGCA
TAACCCAGGGGTATCCCCAAACAGGATAGAGACCACCCCGGGTCTCGGACTTCTTACGACAAGTCGTGAAGTCCTTAAGGGGAATGCGGTGTGGCGCGAG
AAGCACACACCGAGCAGCCTCCACGTTGTCGACGAACAACTGTTCTTTCTGAACAAGGGCTCGTTCATAGATGCCCCTAGAAGTGTGGCCGCCCACAAGG
CCACGAGGAGCGACGAGAAGCTCTAAGAAGAGGTCAGCCCCAGAGCTCTCCTCGGGAGGCCAATACCCTCTTGAGTTGATGGCAGCTCCCTGGCTGACGG
GTGCCGCCACCGAACCCCCACGCACACGCTGGGCAGCTTGGAAATCCTCCTGCTGCTGGTCGAGGTCATTCGAGACCTCCCGGGGCTCAACAATGGCACC
CTCCTCTTCCTCTTCTTCCTCCTTCTCCTCCTCTTCATCCGAGGAGCCGAAGAGACTCTGATAGGAGCGTCGAGTCTCCTTCTCCTCGCGGAGTGGAGAC
TTAGAGGCGGTACGCTTCTTTGAGGGCTTGGCGCCTTCGGCTTTAGAGGCCTTAGCGCGCGCAAGACCCTCGGCAAGCGAGAGACGTTTGCGAGGACTCC
CTTCCTCATCGCCACCGGCTTTGGGAGTGCCCTTAGCCTTAACGGCCGGACTCTCAGAGCGCACAGAGGTCCTGGGACTGTGATCACCGTGATCACTAGC
GGACGACTGCACGCTGTCTTCTTTGTGCTCACTGGGCACTGGGCTGTGCCCTCCCACAGAGCCCGCAGGAGCATCATGAGTGCTCTCGGACTCGGCATCG
TCTTCACTGCCCGAGTTGAACTCACGTTCTACGAACCGAGGGTTCGGACGATTGTCTGAAGACGAGGGCGACGGACTGCGGCGCCTGCTTGCGCGCTTGT
CCGCAGCCGCGTCACCCGAGGATCCGATCGCCTCGGAGGCCACCTGAGTAGCCTCCTTAAGTGCAGAGCCTTTGCCCGTGAGGCTTAGTGCTCTTGGCCT
GCGCCTTACCGGCCTGCAGCCTTGGGAGCGTGTCTTAGCATCGC