Description :
From Genome Similarity Track
Location :
Scaffold_1474:1- 2420
Sequence
2419 bases(100 bases per row)
GAGGGCGCATGACGAGCCCTTCCAGCGGGCCACCTGGGCCCGCCGAGGAAGGCCCTTTTCTGTCGGTTCTTCTCAACCCCTTCAGGTGGAACCCACATGT
ACAAGGTGGGTCGCCCCGGTACGTCCAAGACATGTGAAACATGTCAGCGGGTTCAAAACCCGCAGGGCACTCTTCGGCTCCACTACAGAGCCTGCCCGTA
CCCGGCTGGGTTGTTGGAAGTCGATGAGTCTTGACTTCATCTGTGGGCTTCCCGCCGACGGACACGGCAACACCGGAATTTTGGTGTTCGTGTGTCGGCT
GAGCAAGATGGTACATCTTGCTCCAGCTCCCGTCACTGTTACGGGCGAACAAACCGCAAGGTTGTTCGTCGATGGCGTGTTCCGCTATCACGGTCTCCCA
GAGACGATTGTCTCGGACCGAGACCCACGGTTCACTGCTGCGTTTTGGAAAACGCTGTTCCCTTTACTGGGAACTCGTCTGCGGATGTCCACTGCGGACC
ATCCGCAGACAGACGGCCAAACAAAGCGTGTCAATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGCAGCACCACGTACGTGGTCGACGCAGCT
TCCAGTTGTTGTGTTTGCGCTCAACAACGCGGTGCACGCGTCCACGGGTTCACACCGTTTTACTTGAACGGCTTCCGCCACCCCAGAGTGCCTCTCACTC
TTCGAGGAGACAGTGACTCCTCTATTCTAAGTGGGGGAGAGGCTCGGAAAGCCCTTTCCTCTCAGGTCTCGGATGTGAGACCAGTTTCGCTGCGGAAACA
GGTGGAATCCTTTATAGATACCAAGCTGAACATTGTCAGCAGGTCCGCGATGCATGGCAGGGGCCCAAGATAAACAAAAGGAGTACTCAGACAAACAAGG
AAGAGGAAACTTAAGTATATTTGAGATTGGTGACTTAGTGTTGCTAGACACGAGGAACCTACCTCTAGACACTGTTAGCTCTGTCGGCAGCAACAAACTG
AAGCACCGCTTCATCGGACCTTTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCATCGACCTTCCAAAGTCAATGAAGACGCACCCGACGTTCTATG
TCGGACGTCTTAAGCGGTACTTTGACCCGCAGGGGGTTGCTGACTCGCAGACCCCCCTTGACCCAGCTCCTCGAAGCGAGGGCCGGTCACAGTCGTCGAC
GAGGGCGTCGGAGCAGGCACCCAAGCCTCGGTCGGGACGGCAAGGCTGCGGTCAAGACCGTACGCCGGAGGGGCTCCATACGAACGGACCCCGTCGCCAT
ACGCCGAGTACGCTGAGTACGCCGGGTACGCACCATACGCGTACGTCTGGGAGTGTGCCGCAGGCGGCTCCGGACGTGGCAACAAAGCCTCGATCCGTCG
GATCATGCGAAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGATCCACCCGCAGGTGCAGGCTCGCGACCTCTCGCTCCACCAGGTCCAGGCGGCCC
GCAAGACGAGCGAGCTCGCCCTGATTCCCGGCCTGGGCGGCAGCATCACCGCCAGTCCCAAGGCCAAGTGCAATCTCAGGCACGAGGACACGTTGACGGA
GGCGGTCAACCTCAGGGTCCTGTGTCGGACCCGCAGTCGGAGCACTCGGACGAGAGTGGCTCTCGGGATGCGCCGAGTACTCGTACTCGTACGAGGGCAC
CTCCGCCGCTGCTTGACCGGAATGGAGAAGTCCACTTCCACGTGGAGCGGATCCTCCAGGAGCAACGGTGTCGCGGCAAGCGACAGCTCCTCGTGAAGTG
GAGGGGTTATGCCCACTCCGAGAACTCGTGGGAGCCGATTGAACGGCTCCTGATTGACAGCTCGAAGGCTGTCGCAATCTGGAAACAGAAGCGGCGGCAG
CTTCATAAGTAGTCCGGGGCTTCTGCCCGAACGGGGTACGGACGATGAATACATACCGTACCCGCGCTCATCGTGAGCGCTAGAAGCCGCGCGCTTCAGG
ATGTCCCTTGGCAGCATACGCTTGCTGATCAAGTGGGCAAACCTCACACGAAGATCACGCTAGTCCAGGATGTGGGACAGCTGCTGATCTTCATGGAGTT
CCCGTAACTCCGTGAGTGAGTACTTGAGAGTCTCCACCCACGCCCAGAACATGTCCTCACAAGGACTCCACGTGGGACAGTTCTCGGGCAGAACCCAGGG
GTAGCCCCAAAGAGGGTAGAAACCACCCCGGTTCTCGGGCTTCTTACGACACGTAGTGAAGTCCTTGAGAGGGATGCGGTGTGGCGCTAGAAGCACACAC
CGAGCAGCCTCCAAGTTGTCAACGAACAACTGTTCCTTCTGAACAAGGGTACGCTCGCAAATACCTCTAGAGGTGTGGCCGCCCACAAGGCCACGAGGAG
CAACGAGAAGCTACAGGAA