Description :
From Genome Similarity Track
Location :
Scaffold_902:1- 2403
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_902-snap-gene-0.3Telomere length regulation protein TEL2

Sequence
2402 bases(100 bases per row)
AATAAACCAGCACCAACGCTCACAGTATCACCTCACACTCCCATACAGTGCAATGCACACAACCCAACAAATCACCGCACACCATTGGCTCCCACCACTG
GATCAGATCTGTATCCTCTCAGATAGACACTCCCCACACCACACCACACCACACCACAACCGACTCCGACTGGCACATCGAATGATGCCATCTCAGCAGT
CTCAGCAGTCTCAGCACCATGACCACCTCGCCGACACGCAGCGCGTGCGCGCCTTCTACGAGTCCTGTAGAACGCGCATCCAACACGCAGAGCGTGCGTA
CGATCTGCGCGACGCCGCACTCGCCCTCGCGCAGCTCGCGCGCCCGCTGACGCACCCAACCGACTTCGACACGGCCTGGAAGGTGGGTCAGTCCCACTCC
CTCCATCATGCTCCTTCCCTCATCTCACGGCTACTTCTCTCTGTTCTGCTCTGCTCAGCGCATCTACTTCCACACGTTCTACCGCGACATCGCCACGTTC
CTTCTCACGTTCGTGGCGCCACACATCTTACCAGGGCTCTCCGACTCGCAACGCGCCAGCGTATTCGACGTCTTCTTCACACACCACACGCTTCCTCCGC
TCACAGTCCTATCGACGCTACTGTCGTTCATCGCTGCCGCCAAGCCCACTCGTCAAGACAGCACCTCGACGCCATCGGACGAAGCAGCTCTCGGTCTTCA
CCACAGCGTCCGCCTCTTGCAATGTGTTCTTGAAGCACGTGGCGTCTCCAGAGTTGTCGATCAACTTGCAGAGGCATCGGAGTCGGACCAGAGTCACAAG
gCGGGGAACAATCGAACACTCGCGCTCGCGCAGCCGCTCGTCTCCTCGCTGTGCTCCACCCCAGATCTAGTGTTCAACCGTCTCCAGCGCATTACACCTC
CCTTCTTCTCGACGCGAGCCTTCTTCTCCTGTTTGGACTCCGAGTTGCTGGAATCACTTATCGCGCGTGGTCCGACGCCGACGACTGGTGTGGTCTTCCG
CCTGTTCATGGAGAAACTCGCTCGCAGTGGTCGCATCGACGATCTTCTCCGGGTGTGGATGAACCGACCAGATCTGTATGACCCAGACGTTGCCAAGATT
CACAGCCACCTTCTCGCCAGTCTTCCACCCGTGAGCTTTGACCCATTGCTACTCCACCTCGCCAGCGTTCGGGGAGGTGAGAGTATGTCGTACAACGGGA
CGGTCTCATCCCCGCAGTACCGGATGCTTTCGCTACTTCCGGCCTCGCTCTGCTTGAATGAGCAGTTTCTCTATGCTGTGTCACACAAGCTTCTGCTGGC
CAAGCCTGTACGCGATTTGCTAGTGCTTCGGATACTAGCAGAGGTGCTAAATGGCCATTTTGATGCAGTCTTGAAGACAGAGCCTCCGTTGGGGACTGTT
TTCGAGACGGTTCTCCATCGATGGATCGCTGATTCCTTTCCAGTGACCACTGACTACAATTTGAATGCTTCGATGTGTTTCTTTTTGCGGTATTCCATGA
AAATCCTCGACAGCGAAGCATTTAAACATCGCGACTGGACGATGAAGCTGTGCAAGGGGGTGCAGGTGCACATGGCGCATTCTGTCGAGCGCGTGCGGCT
CCTGGGGATGCGAGTCGGCGAGAGCGTTTCCACGATCATGTCTCCAGAGCAGCCTCTCGACTTTGAGATCGACGAGACGGATCCAATCGAGATTGTCAGT
GGTGTTGTCGTATCTCTCACGACTCGTCCACCGTCTCACAACTCGGATTTGCTGGAGTCGCAAAGCGACGCTTCTACAACTCGTTCTGAAGCTGTGAAGA
AGAACGGGAGGACTGCTAGCTCACATAACAGAGCGGGAGACAGACACAAGAAGAAGGGACTTGCAGTGGATCCGGATGAGGTAGTCGATAGTGACGACGA
AGATGCGGCTGTGGAGGCGGATGAAAAAGATGTTGGAAATGAACGCGACGACTCTGACGCGGACTCTGACGTGAGTCTAGAGCCGTACGACCTCGACGAT
GAAGAAGGGGATCTCGGACCGCAACGCCCCGTGTACATCAAAGATTTGCTTGCTGGGCTCCACGCTGAAGATGATCGAGAGAAAACAGAAACTGCCCTAG
CTGAGGCGGAGCAGCTTCTGCGTAGCAACCCGAAGGATCTCCACTTGACCGCCAAGTCAGTTGTGACTGCTCTGCTGCGCCTCGAAGACAAGTACAACAC
GCCAAATTTtGTGGTGATGCGAGCAAAAGCACTTGCGACAGCATGCGCGTTGTCTCCTGCACATGCTGTCCCGTATCTTCAGAAACAGGCGCTGGAGCGA
GAGCAATTGCTTCAGTCTCGACTGGATGTGTTGCAAGCGATGACCGCGGCGGCACAGGAACTGTCCGAGACTGGAGCCTTTCGTCCTACGATTTCGAAGA
CT