Description :
From Genome Similarity Track
Location :
Scaffold_1777:1- 2375
Transcript NameFunction/comments
Phymu_g13632reverse transcriptase

Sequence
2374 bases(100 bases per row)
ATCGCAATGATCTGGAACGGATACGTCGCCTGCAGATTTCCCGGGGATTCACCCCGGATCGTAGGTCTTCCTTTGCCGGTCTCGCAGTCTACGCATTCTC
CCACATATCTCTGCACACTCCGATATAGGCCCCTCCAGTGGAAACGATCTCGGATCCACTGATAAGTGCGACCAATTCCTTGGTGGCATCCTTCCAGGGT
GGTGTGATAGTGATGTAGGATATCTTGCTGGAGAGTTTCCAGAAAGGCCAATCTCATCAGTCCATCTCGATCGTCGTTTGATCCCGTCGTAGGGGAACAA
TAGAAGAGTAGATCATGTTCGTCTACCTCATAGTCTGCAGCGATCTTGCCGTAGGATCGAGATTCAGCTTGACTGAGATCTGCGATCTCCCCGATCAGAT
ACTGCTTCATTCCTGCGATCCATACTTCCTCGTCTTGCGCTCGTCTGATCCGATCGATTCGCATTTCTCGGACTAGCTCTTCTTGGAGGACAGCGGGGTT
GGATCGTGCACGAGTAGCAGCCTGTGTAGCTACAGCTGAAACCCGTACCACTGGATCTTCGATTTTGGGTACAAGGATGTCGCCCAGTCGATTCAGGGTC
ACTAGATCCTGCCGATCCGCATCCTTGTCAACCTCGATCCCGCCTTGTCGCTGAAGAGCGGCGCTGGCCAAGCTGTAGGCGCTTCCATTCCAGTCACGCT
TTACATGCACCAACTCGAGATCGCCTCACTTCTTCAGGCGATCAAggaccttctgcttcagtaGTGTCAATCCCGGGGCCTTGTAGTCGATCTCACCTCG
GACTTGCCTGATCACGAGGTTGGAGTCACCACAGAACATCAAACGTCGTCGATCGAggtccttcagcagctccagaccTAGCAACAGACCGTTGTATTCG
GCTTCATTCACCGTAAGACTCTCAGTATAGCTTGATCTAGCTTTGATCACCTTCCACCCGGGCAGACTCCACACGATCGCGCTGTAGGCTCCCCCGCCTC
GCTTCACACGAGCCGATCCGTCTAAACTGATAACTTACAGCTCTTCATCCCGATCCACTGTAGGGATCGGTGCCTGAATACGACGTTTGGGCTCCTTCTG
AGGTGCGATCGCGATCAGAGCTTGGTCGATCTTGGGTCTGGGTGTGATGCTGGCGGCGATCGCCCCCAGCATTTCGTCTTCACCCTTCGAGCATTTCGTG
ATCTCGAGTGTCCAAGGTGACAGGAGTGCTGACCACTGGCCCAACCGACCTTGGAGCCCCGCCGACTTGAACAACCAGGCAAACGTCGAATGTCGAGTCA
GGACCTTGATCTCACGTCCAACCAGCATATTGTAATAGAGATCTAGGATCCGCAGCAAAGCTAGTACCTCTTTCTCCGCCACGTTGTAATTCAACTCGTT
CACCTTCAACGTGTGACTAGCAAAAGCTATCGGGTGGTAGATCCTGCCATGTTCTTGTGTAAGAGAGGCGGAAATCGCCCAATCGCTAGCATATACGATC
ACCACCGGAGATGTCGTCACATCAAAGTAACGCAAGATTGGTGCTGACAAGATCTTCAATATCAAGGCTCTGAACGCCTGGTGAGCCTTGATCCACCGTG
CCTCCACATCTCCAATGCTAGATCCGAGATCGATCGCCCCAAGTCCCGATTCGGGACTTGATCGAGCTCTGGTTCCTGTCCTGTCGGCGATCTGGCAACG
TCGCGCTCAAAACGATCGGGATCCCGTGTAATCGCGTCCATCCGATCCATGATCCTCCGTAACTCGGGTCGTTTCACCAGTTTTGCGAACTCCACTTCAC
GTAGTTCATACAGTACTGAGGCATAGACTGCGTAATCCTCTATGAATCGGCTGTAGTAGTTGATACTACCCAAGAACGAATGCATCGAACACAGAGATCC
GGGAAATGGTAGGTCGGTCAAGGATTTCAGATCTTTTGGATTAGCTCCAGACCGTCGAGCTATACTCGATGTCCGAGGTATTTCACCTTGTTCATACCCC
AGATACTTTTCGTCACGCTGATCGACAGATTCCACTTGTCACAGGCGCTCAGTAGATCCTCTACTCTCTGGCACATCTGGTCTCACTATCCAGCGGTGAT
TAGAATGTCATCGATGTATGACCTACGGCCCAACATCGATGGTCGACCTGGATTTTCCGGGATCCCCGGCTCGAACACATCAACCAGGCCTTCTAAATCA
CCTGACCGTGAAATCTTCAGGAACCCATACAGGGCGTTGTCGACCAGACGTTGGTAGATCTGGGGAGCGTTCTTCAGCCCAAAAGGCATGCGATTCCATT
CGAACAGACCAAATGGGGTGATGAACGCCGAGATCGCGCGAGCTCGATCGGTCATCGACACCACCCAAAATCCG