Description :
From Genome Similarity Track
Location :
scaffold_1775:1- 2303
Transcript NameFunction/comments
g11684.t1 PREDICTED: uncharacterized protein LOC101063318, partial

Sequence
2301 bases(100 bases per row)
ATAAGTTCGACTTGGTATTAGGCATGCCGTGGCTTGCACGGCATGACCCGGTGATCAACTGGGAGAAGCGTACGCTTGTACGCTTCAACAGCATGGGCGC
GACAGAGAGCGATGGCCCTGTCAGTGCCGCGCATGCACCGGCCGGTGAATGCGACTCCCCGGTTGAGGCAGCAGCGGCCGCCGCTGCCTCCAATCGCCGC
CGCCGACGCTTGACGACTCCGGGAGTCGTTGAGAGAAAATGTGTTTCGACTCAGAAATCTGAGTCTGAGCCGAAGGGTCGCCTGAGCGATCACGTGAACA
AATGTCACGTGAATGAAGGTCACCTGAATGCAGGTCACCAGATTGATAATCATCTGAATGATGATTGTCACATGAATAAAGGTCAGGTGAATGAAGTTCA
CCTGAGTGATGGTAACATACCGGTATTACCGGTATACTTGGAGCCTCCAAGGGTCGCGCCGACGACAGCGCGTCAGCTCTGGGAGCTGACGAAGCCAATA
GAATTCCGGTTCAGGGAACCGATGGACGTGCGTCAGCTCCGGGAGCTGACGTCCCAGGCGCAGGGCCGCTAGTTCCGGGAACTAGCGATCGCACATCGGC
TCCGGGAGCCGATGATACAAACAAAGGCCACTAGCTCCGGGAGTCGACGATGCATTTGATCCATCAGCTCCGGGAGTTGATGGAGGCGTGGCAGCTCTGG
GAACCGACTACGCGGCAGGAGGTGCTGGCGGTTGCAAACGTCCAGCACCAGAACAACCTGCGTGCTCACGTGCAGCAGTGCTGCACGCGATGAGCGGCAC
ACAAGCCGGGCTTGATTGTGCGAGTCAGCTGAAGACATCCGCTGACGACTATTGCGATAACGACCCGTCCAAGGCGAAGGCCCTTGGACGCGGAGCACCT
GGAGCCGGGCTCCAGGGAAGAACTTCACGGCGCAAGCCACAGAAGCTGCGCGAGGCTCAGTCCGGGACTGAGACGGGTGTATCTGCCGAGCAGACACCGA
GTGTCGAGACGTTGAACGTCTTGACACGTACTGGTACTGGATTCCAGTACCAGAAGATGCGGTTAGAGAATCCGCCGACGTGTGCGTCGGCGTTGACCGC
ACTTCCGACTATGAGTTGTAAGCGCTTCGCGCGGGACTTGTACGATGGACGCATCGAACAAATTTGCATTCTCTCAGACGTTGAGAGGGTGGAACGCGAG
GCCAAAGAGCTGAAGCAGCTCGTCGTCGACGGGATCACTGAGGGCGATGACCCCCTCAGTGCGAAGACCAAGAAGCAGCGCTTCGAGGAGCAGAGTTGGG
ACTCGTTGAGGTCGAGTCCCTATTACGACATTCTGCGGGAGTACAAGGATGTACTTTCTGACGATATTCCTTCGGAGCTTCCGAAGGATAAGGGCGTACA
GCACGAGATTGATCTCGTGCCGGACACGAAGTACTGTGTCACGCGGCAGTGGCCACTGCCGCGCGAACAGGTGCAAGCGATCGACGACTTCTTTGAAAGT
CGTCGTCTTGCAGGTCAAGTGCGGGAATCGAAGTCCCCGCACAGTGCCCCGACGTTCTGTGTCAAGAAGCTACAGGGCGGCTGGCGCATCGTTCATGCGT
ACAACAAGTTGAATGATGCGACGATACCGGCGCAGACCCCGATACCGCGAAAAGATGTGATCATCGATTCGATGGCCTTGAGCACTATCTTCAGTGCTCT
AGATCTACGTGATGGATTCTATCAAATCATCATGCGTGAGAGGTATATCCCTCTCACGGCGGTAAGCACTCCAAGCGGTATGCTTTGGGAGTGGCTCGTC
ATGCCACAGGGACTTAAGAATTCCCCTGCGATATTCAATAGATGCGTGACACATCTATTGCGCTCGTTGCGCTACTTCGCACCGAGCTACTTCGACGACG
TGTTCGTCCACAGCCGGGCTGTGAATGGTAAGACGGACGTTGAGATGCACAGGGTGCATCTCCGAAAGCTGCTAGAGCTTATGAGGAAACATAAGCTCTA
CGCGAACCTGAAGAAGTGTATCTTCGTGGCGAGCGAGATACCCGTGCTGGGATGTCTCGTCCGGAAGGACGGCGTGCGCCCTGACCCAGAGAAGGTCAGA
GTGATCAATGAATGGCCCACGCCATCCAATGTGAAGGAACTGAGGCAGTTCCTTGGGCTCGCCACGTACTTGCACAAGTACGTGGAGAACTACGCGGGCA
AGATTCGCCCGCTGTTACAGCTTCTTAAGAAAGAAACTGAGTGGATTTGGACCACCGAGTGCCAAGGGGCATTCGATGCAGTCAAGCAGGGCTTGACTGA
G