Description :
From Genome Similarity Track
Location :
Scaffold_1374:1- 2295
Transcript NameFunction/comments
Phyke_g11823hypothetical protein

Sequence
2294 bases(100 bases per row)
ACCCACGTCGGATCGTCATAGCCTTTCCAGTACACGAGGAATTCTCGATGAACTCGTCCGTAGCGAGTACGTCTCCCGGTCCTCACGTCCGCGATCCGTT
CTACTTCGAACTCATCATCTCCTAATTCCATCTCCCAACTATCCTCCGGCAAGAGCGCTTCGTCGAAATCGAAACGATCTGATTCTTCCATCGTCAGACT
CGCTTTGGGTCGATCAGGGAACATCCGAACGAGCTTCAATTTCGACACATGCACGATCGGGAACAAGTGGTACTCTGTTCTGGCTATCTCCAGTCGAGCT
GCGTGGCGATCTACCATTTCGGCAACGCGGAATGGTCCGTGCCACATGTGGGCTAGCTTCAGTGCGTAGCCTTCTTTCACTCTATCCAAGTATAACCAGA
CCTGAGCTCCTTCCTCAATCCTATGTGGTCGTATTTCCTCGTTGTGTCGATCAACTCGGTCCTGGATCGCCTCACGCAGGCTTTCACAGACTTGTTCCCG
TGCTCACTGATAATGTCCTTGTATATGGTATCTCCACCTTCGTGGATCTTGATCGCGGTGTCGGGTACTGCCTAATGGCAGAAACGCCTCCAATGTTGAT
CGTGGATCCCAGCCATGAGCAAGGTAGAACGGTGTGTCACCTTGAACCCGATCTTGAGCTGTATTCAGCGCGAACGTGAGACGTTCCGCATATTCATCCC
AATCTTGCTGATTAACATCCGAAACGTACATCTTCAACGCACGCGTCAGCGTCTGCACCATCCGCTCTGCAGTTCCATTGGCTTGCGGTCGGTACGCCAT
CGTGGCCCTTTGTTTCTGGCCCACTATCCGGCTGAAAGCACGAAAAATCAGACATAAACCCCGGTTCTCGATCGTGACGTATGGCTTCACTCGCACCGAA
ACGCCGGAAAACGCATTCCTCATAACTCTCCGCAATCGTCTGTGCAGTCCTAGATGAGCTCGCCTTCGCGATCACATATCCAGTGAACAGATCGACCCAG
ATCAATAGCTCCGTGTTACCCTTGAATGATTTCGGCAACAAAGGAATATGATCCATCGCAATGATCTGGAAAGGATACGTAGCTTGCACGTTACCAGGTG
ACTCTCCATGAATCAGAGGGCGCCCCTTCCCAGTCTCACAATCCACACATTCTCCCACGTAGCGCTGAACACTCTTATACAATCTTCTCCAATGGAAATG
CGCCTTGATCCGCTGGTAGGTTCTCCCGATCCCTTGGTGACCTCCTTCTAGGCTTGCATGATAATGATGAAGGAAGTCTTGTTGTAGGGTCTCCGGGATA
ACCAACCTCGCGATCCGGTCTCGGTCTTCCGCAACCTGCGTCGTTGTTGGGCAGTAAAACAGCAGTCCATTCTCGTCCAGTTCGTAATCGATCgcgatct
tgctgcaagCCTTGGCTTCTTCGGCAGTCAGATTGGCTACATCACCCTGTAGGTACGTACTCAAGTCAAGGATCCACTTCTCTTCGCCTTGTGCTTGCCT
AATCCGTTCACCTCTCAGTCGTTGCACGATCTCTTCTTGTAGCACAGCTGGCTGAAGAGGTCGTCGTCTCTGCGATCTAGTCACGGCTGTTATCCTGACG
GTCGTACTAACGGTCTTTGGCAACAGAAGCTCAGTTAGACGGTTAAGGGTGATCAGATCCTGGCGATCTGCATCAGAGACCACGATCGTGCCCTCTTGGA
GTTGTAACGCGGCGCTTGCTAGTCGATCTGCACTTTGATTCCAATCCCTCTTCATATGCAGGAATTCATGCTTCGGCCACGATCGCAAATGATCCGTCGC
TCTTTGACGGAGCAAAGTCAGCCCGGGTGCTTTACACTCGATCTCGCCTTTCATCTGCCGGATCACCAAATTGGAGTCCCCACAAATGACAAGTCTCCCT
CTGTCCAAGACAGAGGGAGGtcaaagcacagcaacagaccTCGATACTCAGCTTCGTTAACGGTCAGATCTTCCATGTATTCAGATGCGGCAGCGATCAC
CATCCATTCCGGTAACTTCCATACGATCGCACTATAAGCTCCGCCACTGCGTTTGACACGCGCCGATCCGTCGAAACTTACGACCAGCAGACCCTCATCT
GGTTCGACCGTCGGTGGGGTTACAGAGATCGCTTCTCGCGGCTCCTTCCTCGGAGCGATCGACGTCAGAATCGAATCGACTTCTTCACGTGGAGTAATGC
TTGCAGCGATCACACCTAAGATCTCGTCTTCTCCCTTCATGCACTTCACGATCTCAAGTGTCCATGGAGACAAAAGCGCGGCCCATCGACCGAG