Description :
From Genome Similarity Track
Location :
Scaffold_3103:1- 2291
Sequence
2290 bases(100 bases per row)
AGATTCTGCCATTTCTCTGTAACGACGGGATCCCACTGATACATATCCAGGTCGCCTAGGGATACTGTCCTTCGCCAACCATCGTCCGATCTCCTCATAA
TGGTCCAGTAATAGTCTCTTGTCGCTGACGTTCGTGACCTGGAGGTATTGTGATCGACCTAGTCCTTGGATTACTGTAGGCACCCACTTCTCGCCCCGAG
TGACCCACGGTTTCTCATGTTCCACCCACTTCAACCGATCTGGCAATTCCCAGGTCTCTCCGGGCTCGATCCAGGTCGTCGTATCCGCCCTTATGATCCT
CATCTTCGCCCCGTACAACGGTCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCCGCCAGATCCAACCTCACTCCGGCT
GGTACCATGAAATCCATCCCGAGGATGGCGGCTTGACCAGGGAGATCTCCAACCCAAATATCGAACCAGTACACCAAGCAACCTGCCAACGTGATCTTGA
TCCGCGTTCTCCCATTCGTACGGTACACGCCTTCACCAATCCCAACACAGTCTTGGATCCGACTCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGC
GGTATCTAGTATAGACACCTCGGCACCACTATCTAGGAGTAGGCTTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCT
GGGGCGTGGTACTTCCAGTATCCACGGGACTCCCCTGTTAGCAGATCTATGGATCCAACATCCTCAGACCCACGGGATCCAGTGACCAGACAGACCTTAG
ATGGATCTGCAGTGACCTCACCCTTGGTAGGCTCAAACCATCGACCATGTTGGCGTTTCTCCCAATAACCACGTGCCTCTCCCCTTGTAGATCCAGGGTT
GCAGAGACTTCGGATCTGGCAAATTCATCCACTTGGCGCAAACTAGAAATCTTGGCAACTGACAATTCATGTAGATCACGTGTATTATCGACTGGATCTA
GGGTCCTGCTTCCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAGTACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCC
TAGTTTAACATCTTCTCGGCCACCTCTGGCAACATCCCTCTGTGCTTGGCTGGATCAAACCACTGGCGGATCTGGTTGTAAAATTCCTCCATCGGACACT
TGCCGACGTCGTGAATCTCGCCACAGCCACGGCACACGTAGAAGCAATGATCTCCGGGATGACCTTTCTTGCCACATTTCTCACATACCAGATGTTTCCA
GCATCCAGATTCGGTGTGCTTCCGGGATCCGCACTGCGAACACCTGACTTGTGCTGTCCCGTCCATGAGATCTCGGGATCTGTACATCCCACGGTCCCCG
GGTACGGTATCCCCCGGTCGAGAGCTGTCTCCGGTCTTCGCCGTTCGGTCGTTGGACGCAGTGAGACAGACTCGACGGTAATCTTCAGGGTCGGAGTCCG
AACCGTCGGATCCTGATTCAGTTCCTGAGTCGGGCTCCGTGACTTGGTGGACACGTCGAGCTGGGGCCGTAGGCGTCGGAGCCTTTTGGCGATACTTGCC
GGACCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACCGCCCGCAGTACTTCTTCAAGCTCGTCTGCGTCAGGAAGTCGTAGCAGGGTCAGC
CTGTCGGCCAGATCCACGTCTCCCAACGTTTCGATGAAATGATCCACGTGTTCCCGCAGTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTA
GACCGGCCACATTTAGTCGATGTAGGTATTCCAGCGGGGATTCATCCGATCTGCGGCGAGCATGGTAGTATTGTCGTGCCACCGACACTCCCAATCCACA
GTACTGGGTCTGGAAACTGCGCAGCAAATCTGGCCACTTGTTCCTGGTGGATCTGCCCAGCTGCCGATACCAGTTCCTGGCTGGCCCCGCTAACAGATCC
GCAAAGGTCAAACACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCTCGCTCGGTCCTCATCTTGATCCT
TGCCCGTGAACTCCTTCAGATCCGATATGCCTGAGATCCGTACCCTCTGGATCATGGACGATCCACCTGCCCCGGCTGTGGCTGTTGCAACCACCGCTGA
CGAAGTGGATGGGCCATCCAGATCATCTGGGTCGAACTCATCATGGGAGTTGTCTCCCTCCACGGACTCCATCTCCACGTCTCGTGCTCC