Description :
From Genome Similarity Track
Location :
Scaffold_2198:1- 2284
Sequence
2283 bases(100 bases per row)
CCGAACCGCCGCCACTTCGCCTGCTCCATCTGTTGCACCCATGTGTCAACATCCGCGGTGTTCTCTTTTCGTAAATGTTAGGCGGGCTGCAGTAATCCGC
TCGCCTGCGGATCCAATTTGATCCCCAATCACCACCTTTTGATCTTTCCCTTAGTAATCCCACCAGAAGGGTCGTTATACTCCCCTCATGCCGGGGAGCC
CTTCTCGGTAGTGGATCTGCTCGTCCACCTCCCATCCGCGCAGCTCCACAGTATGCCTGTATGCGCTCAGTCTCGTCCATCCCCCACAGATCTTCTTTAG
TCCCAAGACCACCTTTCTCGTTTTGTGCTTTACGGATCCGCTCAATACGACTCCTTCACAAATGTTCCTCGAGGATCTGGGGGCTGGATCCATCCTTCCT
CTGTGTATAAGGGCGCCATCTCTTGGACTGTCTTTTCCTGGATCCAACTACCACCACTTCGTCTAGTCGGTTCAATGTACCGAGATCCTGATGCCCGCTT
CTCTCTCCACTCCGCCACCACATTGATTCCGTAAGCGGCACTGGCCAAGCTGTCTGCACTGGCATTCCAATCTCGCTTGACATGCACCAACTCGTGATTC
AACCATCCACGCAGGTGGATCATCACTTTCTGCCGTAACAGTGTTAGGGCCGGGGCCTTGCAGTCAATCTCGCCTCGCACCTGTCTGATTACCAAATTTG
AATCCCCACAAATCACCAGCCTTTTTGGATCTTGTCCCTTTAGTAAATTCAAACCCAGAAGGAGTCCGTTATACTCCGCCTCATTGACGGTGAGGCCTTC
TGCGTAAGTGGATCTGGCTCGTACAACTTCCCATCCGGGCAGTCTCCACAGTATTGCACTGTATGCCGACTCAGGTCTCGTACATCCCCCATCAGATACT
TCTTTAGTCCCAAGATCCACGCTTTCTCGTTTTGTGCTTTGAGGATCCGCTCAATACGGACTCCCTTCACAAATGTTTCCTCGAGGATCTGGGGGATGGA
TCCAGTCCTTCCTCTGGACCTAGTGACGGCCATCACCTGGACTGTTCTTTTCCTGGATCCAACTACCACCACTTCGTCTAGTCGGTTCAATGTAGCGAGA
TCCTGATGCCCGGCTTCTCTCTCCACTTCGACACCACATTGATTCCGTAAAGCGGCACTGGCCAAGCTGTCTGCACTGGCATTCCAATCTCGCTTGACAT
GCACCAACTCGTGATTCAACAATCCACGCAGGTGGATCATCACTTTCTGCCGTAACAGTGTTAGGGCCGGGGCCTTGCAGTCAATCTCGCCTCCCACCTG
TCTGATTACCAAATTTGAATCCCCACAAATCACCAGCCTTTTTGGATCTTGTCCCTTTAGTAAATCCAAACCCAGAAGGAGTCCGTTATACTCCGCCTCA
TTGACGGTGAGGCCTTCCGCGTAACCCGTACAACTTTCCATCCGGGCAGTCTCCACAGTATTGCACTGTATGCTCCCCCTCCGCGTCGTACACGAGCGGA
TCCATCGAAACTCAGGACGTATAGATCCTCATCCACCTGTACCGTCGGGATCGGGATCTGGATCCGGCGTTTGGGCTCTTTCTTAGGGGCGACCCTAGTC
AGCGCCTCATCCATCTTAGCTCGAGGAGTGATGCTCGCGGCCAAGACTCCCAGGATCTCGTCTTCCCCTTTCGAACACTTCACTATCTCCAGTGTCCAAG
GCGAGAGTAAAGCTGCCCACTGTCCCAAACGTCCTTGTAACCCGGCTGACTAGAACAGCCAGGCTAGCGTAGAGTGTCGAGTCAGGATCCGGATGGATCT
TCCCACCAGCAGGTTTGTAATTCAGATCTTACACGCGCAGGAGCGCGAGTATCTCTTTCTCCACTGCTCCGTAGTTCAATTCATTCGGCTTCAGTGTCCG
GCTGACGAAGGTGACTGGATGACAGATCCCCTCATGTTCTTGAACCCGAGCTGCTGAGACTGCCCAATCACTGGCATAAACTATTACCGTAGGTTGACGT
TCCGGATCGAAGTGACGGAGGATAGGCGTGGTCGCGATTCTGTTCCTCAGTTCCACGAATGCGTGTTGAGCTCGGATCCACCGAGATTCTGCCTGTTCCA
TGTTCTGATCCGTCGTCTCTATCCAGCCTGGATTCTCTCTCTGTTGGTACCCGGGTGGATCCAGCTCCTGTTTCAGGTCCTCTTCTGGCGTCCTAACACT
GGGAATCCTTCGTGGATCCCGCATCTCCTGGGGCAGAGCTTGTTGGATTTCATTCTGGACAGCTGGAGTGGTCATCGCGGCAA