Description :
From Genome Similarity Track
Location :
Scaffold_1663:1- 2282
Sequence
2281 bases(100 bases per row)
TGGAGAAGGGCGAACTGCAGGAGAGTTTCGCGGGACACCGTGTACGCTGTGTCTGCTCTGGCCTTCCGTCTGCGCTCGCACTCGCTATTCTCAGGATCTC
TCGACCGCTCCATTAAGCACTGGAACCTCACAGAGATGGGATACGTCGAGACGCTGTTCGGTCATCAGAGCGAGGTGAACGGACTCGACAGTCTGTACAA
GGAACGCGTGGTGAGCTGTGGTCGTGACCGTAGTGTGCGTATGTGGAAGATCCCGGAAGAAACACAACTGGTGTTCTACGGCAACTCGGGCTCCATGGAC
TGCGTCAAGATGGTCACGGAAGAACCCAGCCAAAACCCCGGCCGAGAGGGGTGTGTTTCCAGAGGTGGCAAAAAAATATGTTTAAAAGCGGAAGCTCTCC
GTGGGTTTTAAAATCCGTTAAGAAACCGCGAGGTTTCTCGGTATGGTTATTTATGGCCTTTGTGTGAAACCAGAAGATTCCCTTGAAAACTCGAAAATGA
GTTTCCTAAAACTCATCGCATATACACGTGATTTACTGAGTGTCAGTTGCCAAGTCTCTAGCTGCGCCAAGTCGACGAATTGCCAGATCCGAAGTCTCTT
CAACCCTGGATTTACAAGGGGGAAGCGCGCGGTTGTTGGGAGAAACGGCAACATGGCCGATGGTTTGAGCCAAGGGCGAGGTCACTGCAGATGCACCCAT
GGTTTGTCAGGTCACTGGATCCCGTGGGTATGAAGATGTTGGATCCATGGATTTGCTAACAGGGGAGTCCCGTGGATACTGGAAGTACCGTGCCCCAGGA
AAGTGGTTTCAGACAAGTCAAGGTAGGGGGCAAGATCAACAATGAAAAAGCAATCCTACTCCTAGATAGTGGTGCCGAGGTGTCTATACTAGATACCGCC
TTTGCTCGTAAGGTTGGGTGCCAAGTGGATGGGAGTCGGATCCAAGATTGTGTTGGGATTGGTGAAGGCGTGTGTGCGTTGTGTCTGTGTATGAGGGCGC
TTAGCTCAAATTAAATGGTGTATTAATTATTAATAATTTTACACAATTTATTAAAGTAATTTTAATTTTATCAACAATTGTTTGTTTTTTAATACAACAA
AAATATTTAATACAACAAAAAATAAATGCATATGAAATTAATATATTAATGTTAATATCATTATTAGGTTTAATGTTATTAGTATCGACAAATCATTTAA
TTACTTTGTATTTAGCAACGCGGATCAAGATCACGCTGGCAGGTTGTTTGGTGTATTGGTTTGACATTTGGGTTGGAGATCTCGCTGGTCAAGACGCCAT
CCTCGGGATGGATTTCATGGTACCGGCCGGAGTGAGGTTGGATCTAGCGGATGGGACACTTTGTTTCCCTGACGAGATGCGGATCCAGCTCAGCGGACGA
CGACCGTTGTATGGGGCGAAGATGAGGATCATAAGGGCGGATAAGACATATGGATCTAGCCCGGAGAGACCTGGGAACTGCCAGATCGGTTAAGGTGGGT
GGGAACATGAGAAACTGTGGGTCACTCGGGGCGAGAAATGGGTGCCGACCGTAATCCAGGGACCAGGTACCTCCAGGGCACGAACGTCAGCGACACGAGA
CTATTACTGGATCATTATGAGGAGATCGGACGATGGGTGGCGAAGGACGGAATCCCTAGGCGACCTGGATATGTGTCAGTGGGATCCCGCCGCTACAAAG
AATGGCAGAATCTGGTGTACGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN