Description :
From Genome Similarity Track
Location :
Scaffold_1022:1- 2238
Sequence
2237 bases(100 bases per row)
ATTCAGATCACTTTGGACGGATCGTTGGTTTATTATTTCGACGTTCGGGTAGGTGATCAGGTCGGCCAATAATTCATATTGGGTATGATTTCATGGTTTC
GGCGGGCATCCGTTTGGACTTAGCCGACGTAACATTATGTCTACCTGATCAGGTGCGTATTGGTTTGGCAGAACGGAAGCTACCTTATCGATCGACCATA
CAGACGATCAACCTGAATGATCAACATGTGGTCATACCGGTTGGCACATTGACAGAAGTACGTATAGGGGTTGGCCTACCTAAGGCTAAGCTTTGGGTGA
GGCGAGACGTGGCGTGGGTGCCGACAGTCACTAGTGGGCACGGCCAGATCAAGTATTTGCAGCTCACGAACCTCAGCGATCGTGAACTAATTTTAAATCA
TGGAGCTTCGTTGGCTTTGTGGATGATATCGGACATGATACCTAGATCACCAGGGTATGTATCGATCGGGTCACGGCGGTATACAGAATGGCAAACGCTA
GCGTTTGAAGCGACTACGGAACGAGAGGAAGAGACAGTGGAAGAGTATGCAGGGCCGTTGGTGGATCATCCTGTGTATGAAATGCCCACTCGAATTCTAC
CCCGCCAAACGACATAAATACCGGGGAAGAGCATGTCGCAACTAGACCAAGAAATGACCAACGGAAGTGAGAGTCAAGACCAAACCATGGACGAAAGTTA
TTTGACGAGAAAGGATCAACGATGAACAGAAATACTTTCTGCGATCTACACAATCAAGGAGACTGTAGACTCCAATCGAGGACGAGATCAGCCCAGTGAA
GCGATCGAAGGCGTGAAGGTGATTGCGACGGAAGAGATCCGACATGGGGCAGCTGATCCGTGCCACACACGGTCCAGCCATCAGTCAGACGCGATCGCAA
TTGACGATGGTGAGTTTCAGGAACAGGCCGATCGACTGGTCGAGGACTACGAAGTGGTGAAGATCGACACACCTGCGGAAGAGGAGAAGACCGTGAGATC
TCCAATGGTGATCGATGCGATCGGAACCAGGGATGAGAGTGATCGAGTTAGAGATCAACCGACACAGACGGGATACGAATCAAGCGAAATTGAGGATAAC
GGGTATGAAGGAACTGATCCAGTCCATGAACAGTCCAGCCATCAGCCTGACGGGATTAAGATCGAAGATTGTGAGTTAAAAGACCAGGCCGATCGACGGA
CGAAAAAAGTGGGCAATACCAAGATCGACGAAGAAACGACGAGAGATGAGTTATCGTCAACATCGATGTATTACCATGATGGCGGCGAGTTGTTCGCGGA
AAATGTGGATCAGCACATGGCAGTTCTTCCCGAAGTGGTTACGCCCACACAAAACATTACGATTGATGATATTCAAGTAGGCGATCCCGGCACCCCAAGA
ACCGAGGATCAAGAGAAGTTGCGCCAAATGATTTCGAAGATCCTGCATCTACTTATTGAAAAGGGTAACGCCCTACCTCCTGCGTCGTGTGGGGCAGTTT
GTGACATCGACGTGGGAGGAGCTAACCCGATCGCACAACGGGTCCGACCGGTAGCACCAAAGTTCCGAGAAAAACTTGCCGGTCTGATCAAGGGATTGCT
GTCGGCCAAGATCATTCGACCATCTACATCACCATGGGCGTCCCCCATAGTGGTGATCATCAAGAAAAACGGAGAAGATATAAGGCTGTGTATTGAATAG
AGGAGGGTGAACCAGCTGACTAGGTTGATGGTGTATCCGATGCCACTGATCAGCGAACTATTGCAAGACATGGATAAAGCTATATGGTACTGCTCTCTGG
ACATGGCGAGTGGTTTTTGGGTGGTGAAGATGACGGGAAGAGCAAGGGCGATTTCCGCCTTTATCACACCATCAGTGTTGTTTGAGTGGTTAAGGATGCC
TTTCGGGTTGAAAAATGGTCCACAGATTTACCAACGTTTGATCGATAACGATCTGTATGGGTATTTGACATCGGCGAAAAATCCGAATCGACCACGGCGG
GATCGCCGAAGTTGATCGATGTCTTCACTGATGGTGAACCAGAAAATGATCCAAAACCATCAGTGTTGGGTTGAAGATCTTATATTGATGACATATTAAT
ACCAGCTACGTCGTGGAATGCCCTGTATGAGAAAGTGGAGAGATTATTGGAGGTGTGCGATAAGTGAAATTTGTCGATCAGTTTGGCCAAAGGGTTTTTG
GAGACGTCGCAAGTGAATACCTGGGACATCAAATCTC