Description :
From Genome Similarity Track
Location :
Scaffold_1776:1- 2230
Transcript NameFunction/comments
Phymu_g13631hypothetical protein PHYSODRAFT_332764

Sequence
2229 bases(100 bases per row)
TGATTGGCTGACCGTTATATGCAGGTGACCGTTATaagcagaggaagtcggtatacatgtatagcCGGTGTGTGGCCCACAACAAAACACAAAATTAACA
GTATTTGTTTTCAAAGTTAATGTACCTTGGATTATGTACAAGTCAGAGGAAGTCGGAAATTGGAGATTTTTTATATGGATGAATATCATTAAGTCTCCGA
CTACACTAGAACTCACTATATACCATTTTCGACCAATAGAATGCGCCATACGTCAAACATGGTTTATTAGCGAATGAATGGCCACCGTCTACTTCATTTT
AACCAATCGTAGACGTATTGAGATTGTGAAAGACTCGTGTCCACATCTCTGAAGTATCACGGCTGTCTCCAAAATATTGATATCCTCTTACAGTTTCTCA
GTCATTCGCATATTTTACGCATAACCATCACTCTCCGACTTCTCCGACCAGCCATGAGTCTTAGTGACCTTGCACCTACAAACACGAACGCGCCCGAGAA
GGTGCGGCGAAAGAGTTCCTGAGGTTCCTAAAAGGCGAAGATGTCTGCTGGGACTACCTGGAGGCATGCATGCAGCGAGAAAGAGCTCCCTCCATTCTCG
AAGCCGTCGTGGACAAGTTCGGGATGCACCTCGCTTTCATGGGAGGACGCAAGGGACAGTAACTAGCCAGGCACTCGGTGATGCAGTAATACCAGCAAGC
CAAGAACTGGCTGTTCGAGCAGTTTCCCCAGCATCGcgcagcagtggagaaggatcTACTGAAGAAGGGCCACGTGCTAGAGCGACACTGCATGAAGCGC
GAGTCAGGCACGTTTGTCAACAAGGCACCGGCCTgcacgatgaagacgattAAGCAGATGACAGAGCATCTGTATTCGACTGCTGTTACTGCCGCTGACT
ACCAGGATGCTGCTCTCCTATGCTTACTTTGGTACCCGTTCGGACGAGCTTCAGACTTGACGCTTCTTTGCAAGGCAAACCTGTCAATTGGCTCCGGTaa
catcttcttcgttcgtTTCATTCGTGTCAAGACTTCAGAAGAACAGGGCTTGTCGCTCTTCCCGGATGATGATTTCGCAACATGCCCTCTGCTCGCCATC
GCTCTTGCGTTGATCACGCAACCGTCCCCAACGGTGGCGTTGCTAAGCCAAATTCCAGAGCAACAGTTCTcgtctcaagctgcagtcgcgCCGGCAATCC
CGTTGCTTGACTTGATCGACCATCCAGAATCTGTGGACCAACACGAGGCGTCAGGAGATAAAGCAAAAAGTGTCAACGCGTTACCTGGAATCCACAGCTA
TGTGAATCGTGTCCTTGTTCGAGCCGCTGCTAAGTCAGGCGTTGCTGAGAAGTTGACGTCTCGTTCGTTTCGCCGTGGAGGGGCTCAACACGCGAACGGA
GCAGGCATGTGCGTCCAGTGGATTTTCGATAGAGGAGCGTGGAACATGACGGCGACGAACAAGGCTTTTGCGTACGTCTTCAATACTCTGGCTGAGGACC
ACAAAGTCGGCAGAGTGTTGAATAGCCACGACGCCGAGAAGCCCGTCCATCTGCTGTCGCTGGATATCTTCGATTCCGATACTCAAGCAAAAATTCGATG
CGTCGCATCGTCACTCTTCTGGTCTTCATTGGGTCTGGAGATGCCATCTACAACGTCAATCCGCGGGTCTTCGACACTCTCATGACGTATCTGCTGCGCC
ACTACCCGGAATCGAAGCAAGTGAATGCTAGCGGACTTGTTGTTCAACGGATTGAAGCTTGCTTGGAGAAAGCTATCACTTTGAACGAGCTTCTGGCTTG
GTCATCACACCTAGCCTGTAACCAAGCGCATCAAGCACCAAAGAGAGCACACACGCGCCAGCGGCCACACCAGACATCACAGAGCATCCCATGTTTCGTC
ACCAAGCAGTGTTGATTGAGCAGTTAATACAAGTCAATCAAAACCTTGACACCCGGCTAGCTATGATGTTGGCCAAAGTCTATAACAAACAGCAACCGAC
AGCGCAAGCCATGTGTGAGGATTCAAGCAATGAGCCACCAGCAAAACGACGACGTACCTCTACAGCTTCCAGCGTGAAGGATGTTTGGTTTACATGGTAT
ACGCAAATGCCACGCATGCGGAGACGACTGAAAAGGCGACGAAGCACACACGATCCACCGCCAAACTGGTCGTCGCATTCATGAAGCTCTTTACGCCCAA
CGGTTTCAacttggacgagaaggctgcgC