Description :
From Genome Similarity Track
Location :
Scaffold_378:1- 2225
Sequence
2224 bases(100 bases per row)
GCTCTGATCAGGAAACGATTAAGGCGATTACCGACTGGCCTTTGCCAGTCGACGTCAAGAACATAGAAATTTCCTTGGGCTAGCGGCGTACTTGGACAAG
TACTCGCGCAAATACGCCGCGATGACTATTCATCTCTCTCGTCTCTTACAAAAAAACTAGAAATGGGTATGAGGTGTTTTGCCAGCGTTCCTTTGAAAAT
ACCAAAAGCATCTTGATGCAATCGCCCATTATGGCAATTACAGATCAGGACAGACCATTCCATGTAGGCTGTGACGCCAGCATTTCGCAATCGGCTGAGC
ATTAATGCAGTAACATGTAGACGGTGCAGAGGGCTTCGTCTTCTATCAGTCGCATCAGCTGCAAGCAGCTGAGCGTAATTACCTAGTACATGACAAGGAA
CTGCTTGCCATGAAGTATGCACTGGCTAATTTTTGCTTCTATCTCCTAGGAGATAGATCGTTCATCGTGTATACGGACCATGCGTCATTAGGCACGGCCG
CAAGCAGTCCCAATCTCTTGCAAAGAATCGCGAGGTGAATGTCCTTCTTCGCGGAGCACAACTTCTCCGTGAAGTTTAAGCTAGGAAAGCTTAATGTCTT
CACTGATGTGGTACCACGCCGAACCGACTTCGAGTCGACCGCACAGTCTAATAGTGAGGGCTAGCCCACTGTTTCAACACTAGTTGCAAGTATTCCGTCG
TCATAACTGCTTGACGTCGTAAAGAAGGCCTACTCAGAAGATAAGTATTTTTAGCGCTGATGGATCATTTGATGAATCCATCTCGTATTCCTCAAAAACA
TTTACCGGCCTTGTTTTGATCTTCTTTGGATCGATACACCACATGCAACTGGCTGCTGTATTATAATGCCGTTGTCGGCGACACATCTCGTGTCGTCGTT
CCCTCTTATACAATTTGCGATTCCATATCCTATATGAGTGTCACGATGCGCCAAAAAGTGGGCATCGTGGAAGGGAAAAGACTTACCTCATGGTAAGTCA
CGACTTTTACTGGGCCTGCCAGTATTAGTTTATGCACAAGTCTATTCGTGCTTACGAGGTTTGTCAACGGTAGTAGACTAGCCCTTCAACCCGAGCGCCA
CTGCATCCTCTACCAGGTCCGGCAGAGTGGTCGTAGTCCGTTTTCATGGACTTAGTCTTCGGATTTCCTGAAGACGTTCACAAGGGTAATGTTATTCTTT
TGTTTGCTGACCTATTCAGCAAGATGGATCTTGCTGCAGTTCCAGAGTCGATCACATCACAGAGATGTGCCCGTGTTTTCATTGACACGATCTGTCGGCT
CCACGTTCTACCCCGTGAACTAATTTCTGACAGAGATCCACGGTTGACGGCGGAGATTTGGCAATCAGTGTTCTTATCACTCGGGACTCGTCTGACTGTT
TCCATTGGACCATTTAGAGACAGATGCTCGGACGGAACGCATCCACTCTGTCCTCGAAGAGATACTTGGAGGGTAAGATCAATCCTTCATGAGTCGGAGC
GAGTTCTTGGCAATGCTCTAGCTCTCCATCAACAACTCGGTACATGCGTCAACAACGCATACACCGTTGTTCGTAAATAACTTATGCTATCCACGTCTAC
CCGCCCATTTAGAGAGTTAGTCTTGTTCTAGGGGGTGTTCGACTCGCTCAATCAAAAACCATTCTGGCTCTTGATCATCACGCGTCGACGTAACTTACGA
CGCGAACCTTGCCGATGTCGATGTGATCGACATCGAAGAAATAAACCTCAGCAATAGTGATGGCACTATTGCTGACTCAGATGATGATGACACTGCTGGT
ATATATAGCATCGACAATGACGACACGAGCGGGACTGAAGACATCCTTGCCGAAGAGAAGAATGAGTTCTTAGCATTTCGCACTAGGCGAACTGAAATAA
ACAAAGGCGAGTCAGCCGAATTATTTCTGCAGGCACGAGAAGCGGTGGTCCGTTTCGTGCAGTAATCTATCGCTAACGCGGTGGAAGGGCAGAAACGGAA
CGCTGATAAGGATGGAAGAGCAAACGTTCTTCTTTTTAATGTTGAATAGTTAGTATAACTATCTACGGTAAACCTGTTTTAACATGTAGTTACTGATGTG
AGAAGTAGTAAAATACTACCCAAGTACATTCTCCCGTTTTGTGTACTACATCGCAATGGCAATGCGTACACGTCGAGTTGCCTAGTAGGGTGCGCACGCA
TCCCACATTCTACATCGGTCGGCT