Description :
From Genome Similarity Track
Location :
Scaffold_2477:1- 2221
Transcript NameFunction/comments
Pytiw_DAOMBR242034fgenesh_masked-piw_contig_2477-abinit-gene-0.10Protein kinase

Sequence
2220 bases(100 bases per row)
TGCAAGTGATCTCGTGACTTGAGAACTTGCGCTTGCCCAGCAGATGCATCATGTACTCCAACTCCGAGCTGGAAATGAAGCCGTCGTGGTTCGTATCGTA
GATCTGAAAAGAAATGAAGGCAGATTGTCAAGATAAAGATCCAATAACAACAATATCTATGTAGTACGAAAGCTCAAAGCAACGAGTACGTGCACTCACA
TCGAAGGCTGATTTCAAGTCGGCCTCAGTCAACTCGCCCCTAAAACCAAACAAGATAGTGTGAGCAAAGCCAACCACATATGAATACCGATTTGCGCGTC
GGCACGTACAAACGGAACAGGCGCTGGTTCATCATGCTGACAAACTCCATGAAAGAGATTTTGCCGTCGCCATCGATGTCGGCTTGGCGCATGATCGCAT
CAATTTCTGCTCTACAAATTAAAGAAGAATTATTGGTAAGTCGGACGGCAAATATAACAGTCACAACATTAACAGGTACAAACGTACCGTGTGAGATGCT
GACCCAGTGCTAGCATCACTCCTTCGAGCTCGTCGCGGTCAATGCCCCCAGACTCGTCTTTGTCGAAAAGGGCAAAGGTGTCTTTGAACATCTCCATGTT
GACTGTGGTTGTTCGAGGAACTTGGTTGCCGCCTTTCCCAATCTCGGTCTTCTCAAACTTGGTGTGTTGGGTCGTCATGACTACTGCAAGGATATTCGCA
CGAAGATGCTGAAGTCGCTGGAACGAAAGCAGTCGTTCCCCATGTCCGTCTAAGAGAGGCTCCGTGGACGTTGTGTTCCCCTTCAGCCAGGAGTGCGCCA
GCGCCTCATTCGCAGTCAGGCGAGCCGAAGGATCAGGGTTCAGCAGGCGAGCCAGGAACTCTTTTGCCTCGTCGGAGAGGTCTCGGTACCACGGATTCTT
TACTGTGTTCCCAAAACAAGTGCATCAGATTCTTCGTCTCAAAGCAAAAAATCGCAATACAAGCTGACTCTGAACTCACCGTCGTAGGTCCCTTTCGCAA
TCTCTCGTATGATTTCTGCATCGGACTTGTCGCCTTTCGGATCGAAAGGGTGTACCCCGGTGAGAGTAATGTAAGCCTGTCCAGTTAGCATAAATATTTG
TGAGAGAAATTCGACAGTATGATGACTACTAATTCTCCTCTTGACACCCTTACCAGAACGCCAAAGGCCCACATATCCACGCCAAAATCCTGAGGCTGTC
GTTTGATGATCTCTGGAGCCCAGTACGCACTACACATAACACCACCACCAAGTTCAACAAACAAGCGTCACAAAGTCAAGCTCAACCGAATCAATGTGGA
GTATTAGCAGATAACAGCAGTACGTACATTGTCCCGCTCGGGTGCTCTTCCAACACTTTCTCGCCATTGCGCAGTTTCCTGCTCATCCCAAAGTCCTGCT
CCAACACGCAAGAGTCACCAGGGTTACCTCTCACCCACGCATTGCAACTGTATTGTCGAAGACGCATGGCCGCAGGAATTGTACCGCAATTTTGATGTCA
GCGTCTGGGCTTTGGTTCGAGAGCAAGACGTTTTCAGGTTTCAAATCGCGATGACTGGGCAAGATACATACACGTAAATAATGTCTCTGCGTTATGACCA
GTCATTCACTCATGCTAAAGACAATACACGTGGCGTACCAGATTCCACGTGAATGCATGTATTCCAGCGCCCGGCAGGCGTCGCGCAGCAAGCGACTCGC
GTCTTTTTCCGAGACTGAGCCCTGATTTTCACAATAAATATACCAACAAAAAAGTCACAAGTGAGTCACCAAGCACAGATGCAACAAGGAAATGATATCA
CATACCATGTCGACAATGTAGTCGAAGAGCTCGCCGCCCTGCACGAGGTCCGTGAACATGATCGTCTCGTTCTTCAAGAAGAGCACATCGTGCAGCGACA
GAATGTTCTGGTGCTTTCCCAGGTGGCGAAGCGTTGCGATCTGTTGTAATGACAGATTTACACAAAGTCTGGTTAGCAACCACACCATGAGCTAAATCGC
AATGCACGAGCCTCTCACCTCGTCCCGGATATCTTCCACAGAGCAGAACTTTGGGTCAAAGATCTTGGCCGCGAGCAACTACATGTACATCCGTCAACAG
GGGACGATTCGTCAGTGTTGCACTCAGCGGTATCAAAAATCCCGTGTACTCTCGTGAAAAAGCATTAAATTTACCTGGTCTGTTTCCGTGTCGACAGCAA
GCCGCACGACCGAAAAGCCT