Description :
From Genome Similarity Track
Location :
Scaffold_3133:1- 2218
Transcript NameFunction/comments
Phyta_totarag15092hypothetical protein

Sequence
2216 bases(100 bases per row)
cctccgttagtcggtgtctgggcgctgttggtaagccggatccagcaacttcgcagattttgctgatcccgctacaccacaatggtgcgcgtgcccggat
CTTTTGATGACTCAGGATTTCACCATGAATCCCAAGAAGAAATTCAAGTGAAGACTGAACAAGGGGACCAAGCATCGTCGGACGTCTGatcgacgatgac
gccgcTGAATGAAGCAAGATCCGCGGATCAGCAGAGTACTGGGAGGAGCTCTGTCGACAGAAATGAGGAAGATCTGGAATCAGATCTAGAAGAGAAACCT
CAACCTCCTCCCCAGGTCCCTTCGGGGACCCCAGCGGATCTCGATACGCATCAAGATCTGCAAAACAAAACCGGTAAGGTTAAACCCGAACCGTACGCGT
TCATGACGGACGAAGTGACCGCAAGCCCGCTAGTCGCAAGATCTAatacgaagaagaagaaaacgaagactacgcggaagaaaatgaaggccCCTGAGTC
GGAAGGCGAAGATCAGAAGGAATCGCCATCGACTGGGACCGATCAGGATCTGGAGTTTGTATTTCACCACAAGGCGCTACGCAAGTTCTTACTCCAAGAT
CCAACGATGAAGATCATGAAAGTACAGCAGATCGGAGATCTGAAGGGACCAGTGTCAGCTCCGCCGGAGACGTCCAACAAGCTGACTGCGGTGAAGAACC
TACTTCAGATGCTGAAAGAGGCAGGTCTAGTTGCCGGTGCTTTCGACGCTGACGGACTGTTCGATCTGGATCTAGACACAATCAAATCTACTTCCCAAGA
ACTATTCGCTAGACTAGCGATCTTGGTAGGCGGAAATGGACGGATCGAAGATCCAGAGATCTCGCCCCAGATCATCACGACGGAGTACCAGACTAGCTCT
TCACATTATGCATCGGCAACATCAGAACCTGATTCGGATGGATCTATAGGGTCGCAACGCATGCCTCTCGGACTTTCCGGAGAAGCACTATTGAGATCTC
GATCTCATGGGAAGTCCCCGGATCGGACGCAGCCGCGACAGCAGAGGCCGCCGCAGAGACAGCCAAACCAGATCACGAACGTAACTTCGCCGGACGGATC
AACAGGCAGACTGGAAACGTACTTCCAAGCTGCTATAAGCCGATTCCTCAAAGAACAGCAGATCACGGTACCGACCCCGGTCGCGGCCACGGCAAGGAAC
GTTGGCGCGCAAGATGTGGGCATGGAGTCGGTCGGATCGTCCGATCGTCACCCCGATCTCTGGGAGTACGACCCCGACGATCTGGAAGACCCACCCACTC
GTGCCGCAGTGGCCACAGCAACGGCTGGATCGACTAGATTCGCGCTCATCCGACGTGTGCAGATCTCAGCAATCTCGGATCTGAAGGAGTTCACCGGGAA
AGGTCAAGACGAAGATCGGACAAGAGGGTGGATCAGCAAGGTTAAGTCCGCATTCTTGCGTGATCAAGCCTCCGACGAGGAAAAGTGTATGACATTCGGA
GATCTGCTAACGGGACCTGCGAGGAACTGGTACCACCAATTGAGTCGATCGACCCGCAACAAGGGACCGATCTGTTGCTCAGGTTTCAGATCCAATATTG
TGGCCTGGGTGTCTCGGGTAGCGAGACAATATTACCACGCGCGCAAACGATCTGATGAATCGCCGCTGGATTATTTAACGTTGCAGGATTGCGAGCACGA
ctgaagatcaaggacggTGGACCGAAGGATCGACGTGAACACGTCGATCACTTCCTCGAGACATTTGGAGATCAAGAGTTGGCAGATCGGCTGACATTGT
TGCGACTGCCGGATGttgacgagctcgaagaggTCCTTCGCGCACTTGAGCGTGCCAAGAGCCGCCAGAAGAAGTCGGCACTGGGATCCAGCAAGTACAG
GCAGAAGGCACCGACTCCGGCCCTGCAGCCCCCGCCAAACATGTTCGTGCGATTCAAGCCCAAGCTACGGAATCGGGATCCGGCCCGGATCGAACGACGG
ATCCGACTCTGACGAGGGCGACTATCACCGGATCTACCTCGCGACCAGCAATGAAAAACAGCCAGCAGCCGAGGGAGACTCGATCCATGAGGACAgaagc
caagaagaccgACGTCCTTCAGATCAACCGTCTCGAGATCACAGATCCAGGTACCAGGCTAACGGACCCGATCGCAACCGCTGTACGCATTGTGGATCTC
GCAAGCACACAGATCT