Description :
From Genome Similarity Track
Location :
Scaffold_1506:1- 2199
Sequence
2198 bases(100 bases per row)
GCAGGGATGGTGCGTGAGAGTAAGTCTCCGCACTCGACACCCACGTACTGTGTCAGAAAGCCGAACGGCAAGTGGCGCATTGTTCATGCTTTTAACAAGC
TAAATGCGGCCACTATCCCGGCGCAAACGCCGATTCCTCGCAAGGATGTTCTGCAGAACAACATGGTAGGCTGTACGTTGTACAGCGCGCTCGACTTGGG
CGATGGCTACTACCAATTGCTCATGAGAGCGAGCGACATTCCGCTGACAGCGGTGAGTACTCCGAGCGGTATGCTCTGGGAGTGGCTGGTGATGCCCCAG
GGGCTGTCGAACGCACCAGCAACGCTCAATCGTCTTGTGACGCAGTTGTTTAGGCCCCACCGGGCGTACGCTCAAACGTACTTTGACGATATATTCGTCC
ATAGTCGTGCCGAGCACGGAAAGTCAGACGTGGGTAACCACATTGACCACTTGCGAGCGGTGCTCGAGTGCATGCGCACTAATAAGTTGTATGCCAACTT
GGACAAGTGCGTCTTTGGCGCGGAGGAGATACCTTTCCTCGGGTGCTTCATTGGGAAGCGTGGCTTACGGGCAGATCCTGCCAAAGGCAAGGCCATCGTG
GACTGGCCGGTTCCCAAGAACCAAAAAGACTTACGCAAGTGGCTAGGCTTAGCCAATTACTTGCACAAGTACAGTGCGAACTACGCGGAGATGGCTCGAC
CATTATCACATCTCCTTAAGAAGGACGCACCATGGTGCTGGAACGTCGAGCACGACGGAGCCTTTGAGGCCGTGAAGGAGAGCCTCCTCCAGGCTCCGAT
CCTTGCGCTACCGGACCCGGATAGTCCGTTTAGCGTCGTCTGTGACGCCTCCGATTTTGCAATCGGTTGTGCTTTACTACAAGCAGACGCCGAAGGGCGT
GAACGCGTGATCGCGTTTGAGTCTCGCCAGCTCAAAGCTGCAGAGAAAGAACTATCCAGTTCATGACAAAAGAGCTACTTGCAATGAAGTATGCTCTAGT
CAAATTCAGGGTACACCTGCTAGGCTCTAAGCCTTTTGTGATCTTTACTGATCATGCGTCGTTACGCACTGCGACACAGTCGCCTCATCTCTCTCAGAGA
ATGGCAAGATGGCTTTCCTTCTTTGCCGAGTATAACTTCGAGGTGAAGTACAAGCCGGGGCGGCTTAATGTAGTGGCCGATGCGCTCTCGCGCAGGCCGG
ACTACGAGTTAGCTCATGTCACGACAGTGACGTCGTCAGTGCCTGACTTGATACGCGGAGCGTATGCACAAGACGACATGTGCGTAGCGCTGCTACGGGC
TCTTGGGAGCGAAGAGTTTAAAGACTCTGACAAGGAATTGTCTGGGCGCTTACGCGCGAGGCTGCATCGATACTCACTCGATGGCGGCCTGCTGTACTAC
AGCACCGACGCTGAGGATAACCCTCGTGTAGTCGTTCCTCATGATGAGGATCTAGAGTATCGAATCCTCTATGAGGTTCATGATACGCCCGTGGGCGGGC
ACTTAGGTCGGGAGAAGACCTATGGCTCGGTGAGCTCGATGTACTGGTGGCCCAAGATGTATAAGTGGGTTGGCACCTATGTACGCACGTGTGAGACGTG
TCAACGGACAAAGTCCGCGCCGAGCACGGCAGCGCCATTGGCGAGTTTGCCTGTCCCCAAAGGGATGCTGGCAGTCCATGAGTATGGACTTTGTGTTTGG
CCTTCCCAAGGATAAGGCGGGAAACACAGGTATAGTGGTCTTTGTAGACCGATTGAGCAAGATGGCTCATTTAGCGGCAGTGCCGGACACCATTGATGGT
GAAGGTACAGCTTTGCTGTTTTTAGACCGAGTCTTTCGCCAACATGGCTTGCCTGAGGCAATTGTCTCGGATCGAGATCCGCGCTTCACCGCGAAGTTCT
GGACGTCCCTCTTCAGAGTGCTCGGCACTCGTTTGGACATGTCCACGGCGGACCATCCGCAGACCGATGGTCAAACCGAACGCGTGAATCGCGTTGTGGA
GGATACCCTCCGAAGTGTATGCGCTGAGGCGCCAAAACGCTGGAGCCAGATGCTCCCACTCGTTGAGTTCGCATTAAATAATGCAATGCACGCCTCGACA
GGCTACACTCCGTTCTATGTGAACGGCTTGGTTAACCCTCGCGTCCCACTGACGCCGCCACGCAGTGGCTCAGGGCTTGGTGGGGGGAGGGATAGCCG