Description :
From Genome Similarity Track
Location :
Scaffold_2807:1- 2194
Transcript NameFunction/comments
Pytul_var.sporangiiferumsnap_masked-pug3_contig_2807-abinit-gene-0.3RNA helicase

Sequence
2193 bases(100 bases per row)
CCACGGCCGACCAAGCCAAGGAGGTCACGTGGGACTTCCTGTTCGGCTTCTTCCAGGATCTTCACCAAAGGACCGGCTAACCGACCGTTGTCTGCGGTGA
AAAACGAAATCGCGTTACCCTTCGTACCAGCGCGCGCCGTACGACCGATACGGTGGATGTAGTCTTCAATGTTCTTCGGCATGTCGAAGTTGACCACGTA
ACGAATGTCCTTGATATCAAGACCACGCGAGGCAACATCGGTCGCGACAAGCACTTGCGTCTTGCCTTCCTTGAATTCTTTCAACACCCAATCACGTTCT
TCCTGCGACTTGTTACCGTGAATAGCCTTGCACACGTATCGGCTGTTACGAAGGTTGCGGCTCAGCTCATCTGCACCACGCTTCGTTTCACAGAAAATAA
TGATACGACCGCCTTCATAGATGTCCTTCATGTGGTCCATAAGGGCCGAGTACTTCTGGTGGTCATCCATCACCTCGACGATTTGCTTGATGCTCTTGTT
GGCCGTCAAGTCCAACGAACCAACAGTGACTTGGATGAAATCGGTCAAGAAGTCGTGCGCCAAGGACACAATTTCCTTCGGCCAAGTCGCGGACCACATC
AACGTTTGACGATCTGGACGAATTTGGCTCACGATCTTGCGAAGTTGAGGCTCAAAACCCATATCCAACATGCGATCAGCTTCATCAAGCACTAAGTACG
TGACACGGCGAAGGTTGGTCTTGCCCATGCCAAGCATATCAATCATACGACCTGGAGTACTGTGGACGTCAAACAAGCAAGCACATCGTTAGATTCAGCT
GCTTCAAGCGCACACAAATACAAACACAAAACTTACCAAATACAGATCTCCACACCACGACGAAGATCGGCGATCTGGCCACCCTTTGGCACACCACCGT
AAATACAGGTGTTCTTGATCTTGGAACTTGCGCCGAACTTGTTGGCTTCTTGTTGAATTTGCACGGCAAGTTCACGAGTCGGAGCAATAATCAGGACAAT
TGGACCATCGCCAGGCTGCAGGTATGGCTGTAAAAGGAAACACACACACAAATGTTAGCATCGTGCTTGGCTCCCGATCACACGCGTAGCAACGAAGAAA
GCAACCACGAAGCGCCGAGAGGTTGAGATGCGTACTTCTTTTGCTCCGCAGACAATCAATGAAAAACGGACGTATTCATTGACCAATCTGGAAAAGAAGC
AGGTGTGGGGTGCTGGGAGCTGTCCAAAAACGCCGAATGGATTCTTTCTCGACAATTCAAATCTTCAGTTTCACATATTCCCTTTCGGGTAGCGAAAACG
AACAAGTGAACGTCTCCCATCGTGGTTAAATTCTGGCGCACGCTGACATCCGAGTTGTGCCAGCGCAGATTTTGGTACGCACGCAATCTTTGTTCCACGA
TGGATCGCACTTTCGTTGCGATTCGAAGAGAACGCAACTCCCACACGAAGGACACCAACCGAGAATGCAACGAATCGAGAGACAACGGCATCACGACCTG
GCCATCATCACCAGAGTGCCAAGTCGCTTTGAGTCGTCAACCGCTCGTTCCATCGTCGCACTCAACCACAACACCGTACCAAGGTGTTTTGTACTGCATC
AATAGTACTCGACACTTCTCGCGATTACGACCCCAAGGTCGTACGACGAACGCGTACTTTCCATATTTTCGAAATCGAAAACAGAGCACAAAATGCGACT
GCACAACGTGCACCGCAAGATGACTCGGTTTTATACACAAACCTGAGCGTTGATGTGGACGATAGCTGGCAGCAAAAATGCCAACGTTTTACCGGAACCA
GTCGCAGAAATGCCGACCATATCACGACCAGAGAGAGCCATCGGCCAACCCTGGCACTGGATCGGCGTTGGGTTCGTGAAACCCAAACGCATCACTTCGT
CAAGAACGTATTCTACAAAAGAATATAAGAAGCAAGGTCGACAATGTCAGCATTCCAATCCGCTTGGCAAAAAGAGAGTCTTTAAACCATTCAACCACAC
CTGGAAAAGACGCTTCTTCAAACGTGTACACGCACTTTGGTACGCCCTTGCCATCCACCTTGATGTCGTGCTTGCGTTTCCAGTCTTCGTATTCTTGCGG
AGAACGCTTCGTCACGTCTGGGTGCTCATAGTAAAAGTTCTTCTCAAACACTGGCAGCTTCGAGAGATCCCACTGGATGTTCGAGTCCAAGTT