Description :
From Genome Similarity Track
Location :
Scaffold_2845:1- 2189
Sequence
2188 bases(100 bases per row)
GGGATCCACTTTGGATATATCAAATCGTGACCTCCCTCTGTGGTCAGTGGTACCTCCGGGGATTACCCACCATTACTTTCTCCCCTAGTCCTTCGGCGTG
TAGATGCCCGCCTTTCATGGTAACCAAACTTGCTCATCTTCCGTTCTTCGTAGGATCCCATCCATTGGATTCGAACACCGCGGCTTTCTTTCGCCTGGCA
GTCCTTCTGTCTTTCGGGGAATCAGGTACCCCTGATATCAGGAAGACCAACAGTTGGGATCTAGTCGGTCCTCTAACGAGTTTAAGTCCGACGGTTCTGG
TTTGACTAGTGTTGCCACTCTCGATAGGGATCCAGGCACTTTATCCAATGGGAAGCCTGAATCCCATTGGATAAAGTGCCTGGATCCCTATCGGAAGCCT
GAATCCACTCGTGGATCAGCGGGATCCGGCTGTTCGGCTTTAGCCCTCTGCAATCCTTCATCCACCGACCCTGCGTTATCTAAAGGCCGACTCTGGGGAT
CGTCCCCCGTCGTGGATCCAACCTCCATTGCTTGGATCTCAACCCGTCGATCCCTCTGCAGGATCTTTCGCGGAGTTGGATATGGAGGCCGATCCACCAG
GGGGCCAGTTGGCTCCGCCGGGAGCTCCACCTCTCCGAGAGATTCGATCTCGGTAGTCGCCTCGTACACCAGATTCTGCCATTCTTTGTAGTGGCGGGAC
CCCACTGACACATATCCAGGTCGCCTAGGGATACCGTCCTTCGCTAACCATCGCCCGATCTCCTCATAATGGTCCAGTAATAGTCTCGTATCGCTGACGT
TCGTGACCTGGAGGTATTGTGATCGACCTGGCCCCTGGATTACCGTAGGTACCCATTTCTCGCCCCGAGTGACCCACCGTTTCTCATGTTCCACCCACTT
TAACCGGTCTGGCAGCTCCCAGGTTTCCCCGGGCTCGATCCAGGTTGTCTTATCCGTCCTTATGATCCTCATCTTTGCTCCATACAACGGTAGCCGTCCG
CTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCCGCTAGATCCAACCTCACTCCGGCCGGTACCATGAAATCCATCCCGAGGATGGCGT
CTTGACCAGCGAGATCTCCAACCCAGATGTCAAATCAATACACCAAACAACCTGCCAGCGTGATCTTGATCCGCGTTCTCCCATTCGTACGGTACACGCC
TTCACCAATCCCAACACAGTCTTGGATCCGACTCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCTAGTATAGACACCTCGGCACCACTA
TCTAGGAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCTCTACCTTGGCTTGTCTGAACCACTTTCCTGGGGCATGGTACTTCCAGTATCCACGGGACT
CCCCGGTTAGCAGATCCATGGATTCAACATCCTCAGATCCACGGGATCCAGTGACCTGACAGACCTTAGGTGGATCTGCAGTGACCTCACCCTTGGTAGG
CTCAAACCATCGACCATGTTGGCGCTTCTCCCAATAACCACGTGCCTCTCCCCTTTGTAGATCCAGGGTTGAAGAGACTTCGGATCTGGCAAACTCATCC
ACTTGGCGCAAACTAGAGATCTTGGCAGCTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGACGTCT
TGTTCACAAATGCATAAATGCAGTACCTAGAACGCTCGGCTCGTACCGGATTCCAACCCGGCGAGCGTCTAGTTTAACATCTTCTCGGCCACTTCTGGCA
ACATCCTTCGGTGCTTGGCTGGATCAAACCATTGGCGGATCTGGTTGTAGAATCCTTCCATCGGACACTTGCCGACGTCGTGAATCTCGCCACACCCGCG
ACACATGTAGAAGCAATGATCCCTGGGATGACCTTTCTTGCCACACTTCTCACAGACCAGATGTTTCCAGCATCCAGATTCTGTGTGCTTCCGAGATCCG
CACTGCGAACACCTGATTGGCGCTGTCCCGTCCATGAGATCTCGGGATCTGTACATCCCACGGTCCCCGGGTACGGTATCGGCAGTGCGGGAGTTGTCTC
CAGTCTTCGCTGTACGATCGTTGGGCGCAGTGAGACAGACTCGGTGGTAATCCTCTGGGTCGGAGTCCGAACTGTCGGGTCCTGATTC