Description :
From Genome Similarity Track
Location :
Scaffold_3163:1- 2172
Transcript NameFunction/comments
Phyta_totarag15113reverse transcriptase

Sequence
2170 bases(100 bases per row)
GTGGCAGGCACTTTGCCAAAGTTGGAACGCCTTTGTtgaaaacttcaacaaagaTCCTGCTGGATACCGTGCTCGAATTGTTTCAGCACGGGAACGCTTC
GAGGAGTTCTCGAAGCGCGGCAAGTTAGATCGCTTGCATGACGAGGCCATGGAGGAGGGATTCCCTGCGCCGTGCCCGCCGGAATGCCGTGTGTACATTG
CCACCCCGGGGCAGCACGATTGACTGACAGTGATGTCAACGGGTACACGACCGTGCGTGTACCTGAAAGTCTTCGTGACCTCCGTGCTAGTCTGCAAGCA
CGGGAGGCTCCGAACATTGTAGGGAACTACAGCGTGCGCACAAGCTTTACGCCTGCAGTCCATGGTGGGCTTCGTACGCCGTCACCATTTCCGGAACGTC
CTCCATCAGGACGTTCCGGGGTTCCCATGTATCTTGGAGGGGACCAAATCCCCTCCAACGAATACGAAGACGAGCCTGACTCGTCTTCGGGTTGGCATGC
CCAACGATCCGCTCCACAATCCAGCGGATCGAGCCACGTGCGTCACGCAGTGGCGGCGGGGGAGGGGGAAACACACCCCTCGTATGGTCAACCAGCTATT
GATCAGGGTGACTGCCGTCTCCTCGACCGGCTGTCGGCCATGAAGATGCATCAGAGCGCTGAGTTCGCCGCtctgaagcagaagatgagcCTGTTGAAGG
CTCAACTCGCGGTGGTTTCGTAGACCGCCTCGAAATTGAGTGTCGAGCTTAGAACGAAACTCTCAAAGTTGACGAAGCAGGTCGTTTCGCTTGAGAAGCA
GGTCGcccctgcttcttcctcggtCTCGGCGGGTCACTAACACTAGGTGACTCGTGTTGCACGTACGGCTTCAGCCGCCTGACATAGAATGTCGGATGGA
GNGGCATGTGCGTGTCCAAGTTCGGTGTCTGCGCCCTGCTCAGACACATGGTTGTTGGTCTTCGCTACAAGCCCAGCTTGTGCGTGTTTGTTGTTCGCAG
CAGGCCCGGCCTGTGCGTGTTCCGGCAAGGTGTCTGTGCCCGACACAGACACGGCGTTCTTGCGTGTAGTCGCAACTGATAGTGTGGACGTATCAGTTGT
TTTCTGCGGTTGCGAGTTCCCAGCCGTAGATCCTCCCCCACTTAAGGAGGAAGCCACCGCCCCGAGCATGCTCGNGCTCCAGTCATGGAACGAGTGCGCG
TAGCTCTTGAGCACGTCGCTGAGCACGCGAATCACGCGCTCGATCTACCCGTCCGTCTACGGGTGGTCCGCAGTCGACATCGACAACTGCGTTCCAAGAA
GTGTAAACATTTCTTGCCAGAACCACGCTGTGAAGCGCGGATCGCGATCCGACACGATGTCGCGCAGCATGCCATGGTGTTTGAACACCGTGTCCACAAG
CAGATGTGCTGTTTGCACGGCTGTCACTTCAGccggcactgcagcaagatgcaccatcttgctgaatCGGTCGACGAAGACCACCGCACCTGTCCTCCGC
TTGCGGTCAGGCGGAAGACCAAAGATGAAGTCCATCGAGATGGACTGCCAACACTCCGACGGAGTCGAAAGGGATTGCAGCGGAGCCTGAGAGAATGAAT
TAGGCTTCACGCGCTGGCATACTTCGCAAGTACGAACGTACTTGCGCACCCATTTGTACAGGTGCGGCCAGTAGAAGTCGCGCGTGAGGTGAACGTATGT
CTTCTCACGACCCGGATGCCCTGCCGTAGGGGCATCGTGGTATTCGTACATGATCCTGAGCTTCAGGTCATGGTCGTCAGGCACGACATTGCGATCCGCG
TTGTCGTCGACTGCGCTGTATAGCAGCAAGCCGTCGTGCACTCGATAACGATGTGCACGAGCGCGTAAGTGGCGGAACATCTTCTGACGAGCCTCGTTAG
AAGGTGCTGACACGTAATCAAGCATTATTTCGCGTCTGCATCGTGCGCAAACGCGGCTttcacgtcgtcgatcagaGACCACGACGGGGTACTCGAACGA
GCGACGCCAATGCCATTGGCTTCGGCTGTCGTGACAGCGCGTCGGCCACCACATTCAATCTTCCGGGTTTGTACTCGACCCGGAAGTTGTATTCAGCAAT
GAGTGACAACCACCTTGCCATTCTTTGAGAGATGTGCGGCGACTTGATCGCCGTACGCAGTGATGCGTGG