Description :
From Genome Similarity Track
Location :
Scaffold_3168:1- 2162
Sequence
2161 bases(100 bases per row)
GTGTGACGCGTCCGACTTTGCAATCGGATGcgcgttgatgcagctcgatcaCGAGGGTCGTGATCGTGTGGTCTTTTACCAGTCGCGTCAGCTGAAGCCA
GCTGAGCGTAACTATCCGGTACATGACAAGGAACTCCTTGCCATGAAGTATGTAGTCGCATAATTTCGAGTGTATCTACTTGTGAATAGACTGTTAATGG
TCTATATAGACTGTTAATAGACCATGCATCACTGCGTACGGTGACCAAGTCGCGTCACATCTCTCAGAGAATGGCATGGTGGTTGTCATTCTTTGCGGAA
TACAACATCCGGGGCAAGTACAAACCCGGAAGGCTGAAcgtggtggccgacgcgCTGTCGCGTCTACATTATTACGCTGCCAAAGACAGCCGACGCCAAT
GCCATCGACGTCGCTCGATCAAGTACTCCGCCGTCGTCtctgatcgacgacgtgaaggtcGCGTGTGcgcacgacgcagacgcgaaAGAATTTCNGTGCC
TGACGACCATGACCTGAAGCTCAGGATCATGTACGAATACCACGATGCCCGCATCCGGGTCGTGAGAAGACGTATGTTCTTCTCACGCGAGGTTTCTACT
GGACGCGCCAGTACAGATGGGTGCGCAAGTACGTTCGTGCTTGCGATGTATGTCAGTACGTGAAGCCAGTCCTGTTCTCGCTGGCCCCACTGCAGTCACT
CCCGACTCCATCGGAGTGTTGGCATCCCATCTCGATGGACTTNNNNNNNNNNGTTCCATCactggagcgactgcttgCCGATGGGGgagttcgccatcaa
caactcgGTGCATGCCTCGACTGGGCATTCACGAGATTACGTGAACGCCGTGCGGCAGTCATGCCTGCCGACCATGCTCGGTGTGATGGCTTCCTGCTTT
AGTCGAGGAGGGTTTATGGCTGCGAATAATCAACCGAAGAAGACAAGTGATACGGCCACAATATCAACTGTGACGACGGACAATAACACCGTGTCTGTCC
AGGGCATATACGCCGCGAAGGAATACGCACAGGCCGGTCCGACAGCGACGGACAACCACCCACGTGTCTGCGCAGGACGCAGACACCGAACACGAACACG
CATAGGCTGGACCTATAgcggaagacgaagacgagctgaACAAGTCATTCAATTCGGAAGCAATGGGCTTTGTCCAGCGTAAATAAGACGTCATTCTATT
TGTCCAAGATGCAATAGTAGCTCTGTCGATCGGCAGAAGCTGAATGCTGACAATGTCGGCAGAGGCAACACTAACGGATTCAAGAAGGGTTCATTGGTCT
TATTAGCTACTTAGAACCTAGCTAAACATGCAATCTCTGACTTCGAAAGAAGCAAGCTTGTTCCGTGCTTCATTGGACCGTTTACTGTGCTTGAGCGGCA
CGGCAACGCGTACACGCTCGGCATACCGGCCAGTATGCGGCTCCACGCGACGTGGAACGTCGGGTGGTTGAAGCcgtacgtgcagcacgaaTCATCTAGT
GTTGGTGACccgccgaagacgacgaagaagcaggggtgagctgcttcatcaacttcgtGAACTTCACCCCAAGCTCAacgctcaagttcgaggcgGTCTG
GGATAACGCCGCGATCTGAGTCTTCTGAAGGATCGCATCGTGGCGAACTCAGCGCTCTGAAGTGTCCCACAGCCGATACCCGGTCATGGAGATGAGAATC
GCATTGGTCAATCTGGGGTTGACCATACGATGGCGTGttcaccccccccccccgcgccGCCATTGTGGGTCGCACGTCGCTCGATCCGCTGGATTGTTGA
GCGGATAGTTGGTCATACCAACGCGAAGACGTTCCAGTCAGAGGCCCGTCTTGATATTCGGTGGAGAGGATTTGGTCCCCACCAAGATACATGGGATAAC
CGCGGACCATCCTGATGGAGGACGTTCCGGAAATTGTAAAGGCGTACGAAGCCCACCATGGACTGCAGACGTAAATCTTGCGCGAGCGTCGTAACCGCCT
ACAATGTTCGGAGTCTCACGTGCTTGTAGATTAGCTCGGAGCTCACGAAGACTATCAGGTACGTGCACGGTCGTGTACCCGCTGACACCACTGTCCGTAA
GGCGCGGTGCCCCGGGGTGACAGTGCACACACGGCATTCCAGCGGGCACTGCGCAGGGAAT