Description :
From Genome Similarity Track
Location :
Scaffold_1322:1- 2144
Sequence
2143 bases(100 bases per row)
ATCGGGGCTGGTCCACCTAAGGCTAAACTTTGAGTGAAGCGAGATGTGGCGTGGGTACCGACAGTGACTAGTGGACCTGTCCAGATCAAGTATTTACAAC
TTACTAACCTCATCGATCGCAAATTAATTCTAGGTCATTGAGCTTCGTTAGGTTTGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATATGCAAGGCCGTTGGCGGATCATCCTTTATATGAAATGCCCACTCGAATTCTACCCNNNNNNNNN
NTCGCAGCCAGGCCAAGAAATGACTAACAAAAGCAAAGCTCGAGATCAAACTACGGACGGAAGTCAGTTGACAAGGGAGNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAATAGAGACACCTTCTGCGATCTATACACTCAAGGAGATTGTATACGCCA
ACGAGGACAAGATCAGCCCAGTGAAACGATCGAAGACGTGAAGGTGATTGCGACGGAAGAGATCAGACAAGTGGTAGCTGATCCGTTACAAAACCGGTCC
CGCCATCAGTCAGACGCGATCACGATCGAAGATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACGAAGGAGATCGATCGAGCTATAAATCTACCAGCACAGACATTA
TGCGAGTCGAGCGTAATTGAGGACAACGAGTGCGATGGAGCTGATTCAGACCATAAACAGCCTAGCCATCAGTCAGACCGGGATTAAGAGTGAAGATTGT
GAGTTACAAGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTGCTGATTAGGGAGC
AGTTTGTGATATATATGTGGGTGGGGCCGACCCGGTTGCGCAGAGGGTCATGCCTGTGGCCCCCAAATTTCGAAAAAACTCGCCGGTCTGATTAAAGGAT
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGACAAGAGAGATTTCCGCTTTTGTCACACCATCATGGT
TGTTTAAGAGGTTACGGATGCCTTTCGGGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCGATGCTGAACCAGATACTGATCCGGAACAATCGGTGTTGGTTCGA
AGATCCTATATCGACGACATGTTGATACCAGCTACGTCGCGGAAATATATGTGCGAGAAAGTGGAGAGGTTATTGGAGGCGTACAATAAGTGGAATTTGT
CGATCAGNNNNNNNNNNNNNNNNNNNNNNNNNNGACGTCGCAAGGTAGAATATCTAGGACATCAAATTTTGCTCGTAGGCTTGGAAGCTAATCCGAAAGT
TTAGGGATCGTTAGTGAAAATTCCGTTCCTTCGGACGCTGCGA