Description :
From Genome Similarity Track
Location :
Scaffold_3768:1- 2124
Sequence
2123 bases(100 bases per row)
GAAGAACGGGGTGGATATACGTCTGTGCATTGATTACCGGCTGGTTAACGGTCTGACTCGATTGATGGTGTATCCGATGCCTCTAATCAAAGAGCTGTTG
GAAGATTTGGATAAAGTACTCTGGTACTGCTCTCTTGACATGGCCAGCGGTTTTTGGGTAGTTACTATGACGGATCGAGCTCGCGCGATATCCGCATTCA
TCACACCGTTTGGACTGTTCGAGTGGAACCGGATGCCGTTTGGATTGAAGAACGCACCCCAGATCTACCAACGTCTAATCGATAACGCTCTCTATGGATT
CACCCGAATACCGGAACCCAAAAGGGGTGGATCCGGGGAAGATCATACGGAAGTAGATTCATTTGAGGCAGGAGAGCCCGGGGATCCTGGAACCCCGTCC
GTGTTAGGACGCAGATCTCACATCGACGACATTCTAATCCCGGCGAAATCGTGGGATCAGTTGTGCGAAAGAGTGACATCCCTACTGGAGGCGTGTACTA
AGTGGAATCTCTCTATCAGTGTGGTAAAGAGCTATTGCTGGATGCGCAAGGTGGATTACTTAGGCCATCGAGTTTCCAAGGAGGGATTGGAGGCGAATCC
TAAGGACCTGTCTTCGTTAGCCGATTTGTCCTTCCCGCAGTCGTTACGGGCGATACAATCCTTCTTGGGCAGTTTGAACTACAACAGTCGGTTCATCGAG
GATTACGCCCTGTTTGCCGCGGTATTGTATGAATTGAGAGAGGTAGATTTTGCTGCGATGACCACTCCAGCTGTCCGGATCAAAATCCAACAAGCTCTGG
CCCGGGAGATGTCGGATCCACGAAGGGATCCAAGTGGTACGACGTCAGAAGAGGACCTAAAACAGGAGTGGATCCACCCCGGGACCAACGCAGAGAGGAT
CCAGTCTGGATAGAGACGACGGATCAGAACATGGAAAAGGCAGAATCTCGGTGGATCCGAGCTCAACACGCATTCGTGGAACTGAGGAACAGGATCGCGA
CCACGCCTATCCTCCGTCATTTTGATCCGGAACGTCAACCTACGGTGATAGTTTATGCCAGTGACTTGGGCAACTTCACGCGACCTCTGGTAACAAGAAA
CATGTAGGGATCTGTCATCCAGTCACTTCGTCAGCCGGACACTGAAGCCGAATGAACTGAACTACGGAGCGGTGGAGAAAGAGATACTCGCGCTCCTGCG
CGTGCTGGATCTGAATTACAACCTGCTGGTGAGAAGATCCATCCGGATCCTGTCTCGACACTCTACACTAGCCTGGCTGTTGAAGTCGGCCGGTTTACAA
GGACGTTTGGGACAGTGGGCAGCTTTACTCTCGCCTTGGACACTGGAGATTGTGAAATGTTCGAAAGGGGAAGACGAGATCCTGGGAGTCTTGGCCGCGA
GCATCACACCTCGAGCTAAGATGGATGAGGCGCTGACTAGGATCGCTCCTAAGAAAGAGCTTAAACGCCGGATCCAGATCCCGATCCCGACGGTACAGGC
GTATGAGGATCTGTACGTCCTGAGTTTCGATGGATCCGCTCGCGTACGACGCAGAGGAGGAGCATACAGCGCAATACTGTGGAGACTGCCCAGATGGGAA
GTGGTACGGGCCAGGTCCACTTACGCGGAAGGCCTCACCGTCAATGAAGCGGAGTATAACGGGCTCCTTCTGGGTTTGGATCTACTAAAGGGACAAGATC
CAAAAAGGCTGGTGATTTGTGGGGATTCAAATTTGGTGATCAGACAGGTGCGAGGCGAGATTGACTGCAAGGCCCCGGCCCTAACGCTGTTACGGCAGAA
AGTGATGATCCACCTGCGTGGTTGGATGAATCACGAATTAGTACATGTCAAGCGAGATTGGAATGCCAGTGCAGATAGTTTGGCCAGTGCTGCTTTACGG
AATCAATGTGGTGTCGAAGTCGAGAGAGAGGCCGAGTATCAGGATCTCGTTACGTTGAACCGACTAGACGAAGTGGTCGTAATTGGATCCGGGAAAAGGA
CAGTCCAGGTGATGGCTATCACTAGGTCCAGAGGAAGGATTGGATCCAGCCCCCAGATTCTCGAGGAAACATTTGTGAAGGGAGTCCGCATTGAGCGGAT
CCACAAAGCACAGAATGAAGAAG