Description :
From Genome Similarity Track
Location :
Scaffold_426:1- 2120
Sequence
2119 bases(100 bases per row)
GACGCGATTGTTTTCGCGATCACATACCCCTAAAATAAATCGACCCACAATGACAACTCGGTGTTTCCTTAATAAGATCGTGGCAACGAAGNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNTTGCTGCAACTGCTTTGGAAATACCAGATAAGCCAGTTGAGTACGGTCTTCCGATTGGTGGCTGATCTCGGCAAAAA
AATAGCATTCCACTTTGGTCTGCTTCATAATCCNNNNNNNNNNGGTGCGATCCAGGCGCAAACTTTGACTTCAGTCACCGACAATCTAGCCACATCTCTA
ACCAGATATATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNAATCCTGGGCTAACATCGTCTTCTTAGGGCTGATCTAGCGATAGCCGCCACTTTGANNNNNNNNNNTCACGCATAATATGCAGAAAT
TCATGGAATGGCCACGATCGGAGTTTCTCCATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTCTTGCCTAAGAGCTTCACTGATCA
GCCGAACTGCACTCTGATTCCAGTCCCGTTTCATATGCAGGAATTCCTGGGCTGGCCACGATAGAAGTTTCCAATCGCTCTATGCCTCAGCTATTACAGT
CCTGGTGCCTTACAGTCAATTTCTACTCGCATTTGGCGGATCACTGAATTCGAATCTCCGAAGATAATTACCCCTGGCCTGACCGGCAAGCAATCGAAGC
TGAGGAGAAACCCNNNNNNNNNNTCCTCGCATTTGGTGAATCACCAAACTCGATTCTCCGCAGGTAATCACCCGTCTCCTGGCCTGACCGGCAAGCANNN
NNNNNNNTGCAGTCATGGTGCCTTACAGTCAATTTCTCCTCGCATTTGGCGAATCACCAAATTTATATCTCCGCAGATAATCACCCGTCTTCTGGCCTGA
TCGGCAAGCAAATCGAAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCGAAACCGGCTACTAGCGGGTTTTCATTCACTTCTACGGTGGT
TGGTGGCATATTTATCGTCTGTCTTGGNNNNNNNNNNAGCAATCTCCATATAATTGCGCTGTATGATCCAACCTTTCTCTTCACTCTAGCCGATCCATCA
AAACTGTCCACCAGCAAGTTTTCATTTACTCCCAGTGTGGGTGGTGGCATACTTATCGTATGGCTTGGCTACTTCCCCTGGGCGATCGCAATCAGTACTT
CATCCACTTCTTCACGGAAAGTTATACTCGCAGCAAGTGTGCCGAGTANNNNNNNNNNGCCACTAGCAAGATTTCGTTCACACCTACTCCTACAGGGTGG
TGGCATACTTATCGTCTGTCTTTGCTNNNNNNNNNNCACTTCATCCACCTTTTGCGGAGTGTCACACTCGTATCCAGAGTATCCATTATCTTGTCCTCGC
CTTTCTCAGATCGCGTATCTTCACCTTCCAATTTGATATCAACTCAGCCCACCTTCCTAATCTTACGTTGAGGCCAGATAATTGCAATAAACAGGCCAGT
GTTGAATTTNNNNNNNNNNCGTTAGGATTTAGCGCACGAATCTAGGAGGTAACAGGCCAATATACACCGTCATATTCTTGAACCAAAGNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATACAGTCCCCTTT
CTTGCATACAGCAAGATCACAGATGATCGATCCGGATCAAAATACTTCAAAATTGGTATTGTAGCTGTCTTATCTTTCAACAACGTGAATATGATGGNNN
NNNNNNNCTTCATCCACCG