Description :
From Genome Similarity Track
Location :
Scaffold_1703:1- 2095
Sequence
2094 bases(100 bases per row)
CGATGGCAAGGCCCAACTTCCTGCGGCGCAAGCGTCTCCCAAGTTCACATGGGACGGATCACGATACGGCTTAAGCAAACCCACGTACAACACAGGATGT
GTGCGCAATTTTGCGTAGAAGGTTGAGCGTATACGCAAGTCCCTTCTTAGCAACGACCGTGAATGGTCCAATGAAGCGCGGACGCAACTTTGTCTTGAAG
ACCGCGGACACTACATTTGTAGGTAAGTTTTTAGCATTGAGTAATACTTGGTATCCGACCTGATAACGTTCAATACGACTTATGTTTTTAGCATCTGCTT
GTTGTTTTTGTTGGTCTTGGCTTTCATCCATTGTGTCACGCACATGTCTTAAGACATTCAATCGCGTTGCGAGAAACTCGCCTACCTTTTTTTGAACAGT
AGCAGGGCTGATATCAGCAAGCCGATCGGCAACCTCTCCTCCACCAAGCCCTGAACCACATAGTGGTAGCGTTAACGGAACGCGAGGGTGGATGAGACCG
TTTACGTAGAACGGAGTATAGCCTGTAGGGGCATGAATAGCGTTGTTCAACGCAAATTCAACAACAGGGAGCATAGAGCTCCAACGCATAGGCGTATCAG
CGCAAACACTGCGCAAAATGTCATTTATGACGCGATTAACACGCTCAGTTTGACCATCGGTCTGCGGATGATCCGCTGTGGACATGTCCAAACGGGTACC
TAGCACCTTGAAGATGGACTTCCAAAACTTGCCAGTGAAGCGAGGATCTCTATCAGAGACAATTGCCACTGGCAAATCATGTTGTCGAAACACACGGTCG
ATAAACATCTTCGCTGTGCCTTCGGCATCAATAGAGTCCGGCACTGCCGCTATATGAGCCATGTTGCTCAATCGGTCAACAAAGACCGCAATTCCAGTGT
TGCCCTCCGAATCTTTCGGTAGGCCAAACACAAAGTCCATACTCATGGACTCCCAACACCCAGTGGGTACAGACAGACTAGCAGCGGCGCCGCCGCATGT
GCTGAGGGTTTCACCCGTTGACACGTTTCACACGTACGCACATAGGTGCTCACCCACTTGTATAGTTTGGGCCACCAATAAGCCTGGCTCACTGAGCTAT
AGGTCTTCTCACGAGCGAGATGACCACATAAAGCGGTATCATGTGCCTCATAGAGTATTCGATACTTCAACTCCTCATCATGAGGGACAGCGATACGAGG
GTTATCCTCAATATCTGTGCGATAGCACAACAGGCCATTATCGATAGAATATCGATGTAGCCTCGCGCATAAACGTGCCGGCAATTCTATGTCCGAGTCT
TTAAACTCCTCGCTCCCAAGAGCACGTAGCAAAGCTACACATTGTTCATTCTTGGCATAAGCCGCACGGATCAAGTCAGTGACTGACGATGACAGCGTAG
TTACGTGAGCAAGCTCATAGTCAGGATAGCGCGTCAGCCTAAGCATTTTGCTTTCCTGGCTTATACTTCACTTCGAAGTTGTATTCGGCAAAGAATGAAA
GCCAACGAGCCATTCTCTGAGATAGATGCGGCGACTGTGTCGCAGTGCGCAATGATGCATGATCTGTATAGATCACAAATGGCTTTGATCCAAGCAGATG
TACTCTGAATTTGACTAGAGCGTACTTCATAGTAAGTAGCTCTGTCATGAACTGGATAGTTCTTTTAAGCAGCTTTGAGCTATCGAGATTCGAATGCAAT
GACGCGTTCGCGTCCATCGACATCTGTTTGTAACAGAGCACTGCCTATGGCAAAGTCAGATGCGTCACAGACGACACTGAAAGGCCGATCAGGATCGGGC
AAAGCCAGTATTGGCGCATGAAGGAGACTTTCCTTAACTGCTTGAAAAGCCTCATGTTCGGTGTCGCCCCAACACCAATCCACATCCTTCTTAAGGAGAT
TTGATAGTGGCCGAGCCATTTCTGCGTAATTCTCACTATACTTATGCAAGTAATTGGCAAGGCCAAGCCACTTACGTAGATCTTTTGTTTCTTTGGAACC
GGCCAATCGACTATGGCCCTTATCCTAGCGGGGTCCGCTCAAAGGCCTCGCTTTCCAATGAAGCACCCCATAAAGGGAATCTTTTCTGCACCAA