Description :
From Genome Similarity Track
Location :
Scaffold_1557:1- 2093
Sequence
2092 bases(100 bases per row)
TTCATCCGATCTGCGGCGAGCGTGGTAGTATCGTCGCTGCCACCGACACTCCCAATCCACAGTACTGGGTCTGGAAACTGCGCAGCAATCTGGCCATTTG
TTCCTGGTGGATCTGCCCAGCTGCCGATACCAGTTCCTGGCTGGCCCCGCTAGCAGATTCGCAAGGGTCAAACACTTCTCAGCATCCGACGCTTGATCTC
TCTTGAGGGCCGACTTGACTTTGCTGATCCATGTTCTCGCTCGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAGATCCGATATGGCTGAGATCCG
TACCCTCTGGATCATGGACGATCCACCTGCCCCGGCTGTGGCCGTTGCTACCACTGCTGACGAAGTGGATGGGCCATCCAGATCATCTGGGTCGAACTCA
TCATGGAAGTTGTCTGCCTCCACGGACTCCATCTCCACGTCTCGTGCTCCATGTTCGTGGAGCACTTGCACTTGTGGCCCGGGCGCTCTCATACCCTGTT
CGACCAGGAAACGACTCATCGCAGCTTCGAAGTGTCGCTGCAGGGTGCCCGAGGAAGTGTCGGAAGAGCCTGTGGCCGTCTGGTCCACTGGCGAGACCGG
ATCCGTGAGGCGATTACCTTGAGCCCGATCTGACGATAATCCCACTGGCTTCTTGTCGGATCTGGTTCGATCGTGGCTGGATTGTGTCAGATCACGCGTG
GGGCCTACTTGATCCCGAGCCTTCGCGCTCACAGGGACTTCCTGTCCTCGGCTCCTCGCCCGCGCTTCCAGCATGGATGCCCCGGAGGGTCCTAAAGTCA
TGCGTCGTGGTTCGGACGACGTGTCTGACTCATCCTCAGCGGCGGATTCGTAGTTCGAGGACGCAGCTTGGCTGACCCTCGGCGACGACACCGGATCCAT
AGTGCGCGACCTTTCTCCGGTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGCGGATACTATGAGATCCAGGTCTGGCTCGAAGATATCCTCTGCG
TCGAACACACCAGCTACGATGCCTGACTCCGTAAGCAAACGTAATAGATCCTTGACTGCCACCAACTTGTTCGCCGTTTTCGTTGGTGCTCTCACCGGTT
CTCTTGGATCTTCGATCTGTCGTGGATTTAGGATCTGCATGACAGGATCTTGATGCAGGAAGTCGCGTAACGCTTGGTGGCGATACACAAACTCGAGATC
CTTGTCGGACCAGCTTGACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTCTTCGTCTTCTTTCTC
GTTTCTTCGACTAGCGGGCTTGGGTTTAGGTACGATGTTGGCTTAACCGGTGAATCTGCAAATGCATACCGTTTCGCCTTCACTTTCCCTTGTTTTGTTA
GCGGATCTTGACTTGCGTCAAGATCCGCAGGGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGGTTTTTCTTCTAGATCCGGATCCGGATCCACCTCTCT
TCCGTCGACAGAGTTCCTCCCAAATCTCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACTTCCGACGACGCCTCTTCCCCT
GGCTCAATCTTCACTTGAGCATCTTCTTGGGACTCACGGTGATATCCCGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTGGTGTAGCGGGATCAGC
AAAATCTGCGAGATTGCCAGATCCAACTTACCAACTGCGCCCAGACACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCA
CCTTGTGTACCCGTCGGTGAGGCGGGATCTTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGAAGCTTGAGTGTCTTGGCGAGACGTGGGGATGGG
GTGGAGCAGCAGTGGAAAATCTTCACTCTGCGTCCGTGGATTGTTCCGAATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGATCGTGGATCT
GGTCGTAGGGTTGCCTTACGGGTGTGTTCCCTTGCCTTTGTAGTTCCTTTGCGTCGTAATTGCCGCCTCCTGTGACGGGATCTTGAAAGTTG