Description :
From Genome Similarity Track
Location :
Scaffold_825:1- 2068
Transcript NameFunction/comments
Phyci_22498Hypothetical protein

Sequence
2067 bases(100 bases per row)
ctcgcggcagtggccactgtcgcgtaacacaatactttttgccccggacgagatcaatctcatgctggatgcctttatcctgcggaagctccgaaggaat
ttcttccgggagtacgtccctgtactccctcaacaattcgtaataggaactcgacctcagcgagacccagccttgttcctcgaagcgctctcgcttcgtc
ttcacactgagagtgtcctcactctcagtggcacttcccatgaagagctgccccagctcctcactctcgctcttcgttctttcgctgtccgaaaaaaaaa
ccgcagacctgctcgatgcaggtcgcgcgtgaagcgcctccagctcatgactggaagagaagtcaactccgacaccctcgtcggaggactagcgagttcc
atcacacaatactggaacccagtatcggtacgcgtcaagacgttcagcgtcttacgcccggcgccaccgcctctgtctgtccggcagacagctcttgtag
cgtctcggttccggaccgagacttgtgcagcgttcccatggtgttcttctggtccaggcccggccgtggacagctgttcgccgtcggaccctctccgcag
gcgcgcggtatcaagcccggcttgaccgcatgtttcttcgtgcagtccggctgcacggtaatgtgttccttcgtcggcagaccctgtctgcgggcgcgcg
atatcaagcccggcttgatcgcatggcgcttcgtcgtgcatcccggctgcacgacagcatacaaattgcgtcagtacgggacgtttgcaaccgtccgtac
tgtttgcagcgtcaactcccggtgttgacacgcctttgtcacctcgacgccagttattggcggagcccctcattaccgagggtgcgtcgacaaagggagt
cgacgcgtcgtcgtcgacctgacctcttcgggtcagggactgtcccatgcgtacttgaacgcgagtgttggttcctggaaccgacacaacttttccttcc
gacgtcggcagcattgccgacgtggatcccacttgtgcgcatccttgcgcaccccttgggcactcctgaacagcgacattaaacgctctcttgactggtg
agtcgcgcgcacctgctggtgcgtgtgctgcggtaacagggccatcgctctctgttccgttgtcgagaccgaagtgcgcttcttccagtcaatggccgga
tcattccgcgcaagctacgacatgcccattacaacgtcgaacatatcgtccaagtccaggacgataacgtgctcgacaaacactcgttgtttgtacgaga
agcgcacgttcatgacgcgcttctcggtcttcacgaggtcgctcgaacttccagaagacttcgggatacctttcaagtcaagactcggtaagcttcgcaa
tcgaaccacattattcgacgcgactgaatctaccagagttcgaagagggtcgctcgctctcttcgacgttactgtcaagatgaccaggttcggtctgtca
tcttgtttcttgcagcgagatctggtctcactgggggctgccgacctcagtgtcgcgtgcccgatgtcgacacgcgtgactgcattaccagtagggcgcc
ccgcgcctactggatgttcacgtctttttgtttgtccgcggcgatgcccggcatcgccacgacggccactattgtagtgtaggggaaccgtgcactccct
ggcaaagtgaccgacccttctgcaacggaagcatcgcacattacttgcttgctgcaggcgaccggcagccgttgcattcgagaggcccattggctccgga
tctcccgttctcactaccggtcgcagttgcgacctcggcacgttcgcatgcagtttagcctgctgcaggctaaactcttcttgcatggcaagggtgattg
cagcttcgagagtactcgggtactctcgaaacagataggtcttcgcAGTCCCATCTCTCAGTCCCTTCATGAACGTGACGACCTTAGTCGCCTCGTCTAT
CGGGTTGGTCACGATGTTCGAGACCAAGTACCGTGCACGCTGCGCGTAAGAATGGACGTCATGCTTA