Description :
From Genome Similarity Track
Location :
scaffold_1871:1- 2063
Transcript NameFunction/comments
g11739.t1 hypothetical protein PHYSODRAFT_247483
g11740.t1 hypothetical protein PHYSODRAFT_325210

Sequence
2061 bases(100 bases per row)
TTCGTCGTATGGAAGCACAAACCAAGGCTTTCCTGATGAAGACGATGGATGACACTCACATCCGTCTTGTCAAGAACCTTACGACTGCCTTCGATATCTT
CCAGGCCATCTGTACCAAGTATGAGGATGCTGCTTTTCATGGCGATCCTAACTTCATTCAGCATTTCCTTATGGAGATCAAGTACGAGGAAGGTGGTGAC
TTGACCAGCTTCTTCCTTGAGCTGGAAAACGCGATGAAAGCCGCGTCTGAAGCGACCGAGTCTCCCTTGATTGACGGACAGAAGTCCCTGTACCTGTTCC
ATTCGATGCCGAAGACTTGGAAGGATGACCTCCGAGTTTAGAAAGGCGTGCGGAAGTATATCCCGTATGATGAACTCAAGATGAGCATTGAGACCAAGGT
TCGCGAAATCCAGGCTCAAGAACGTTACAGCCTTATCAAAGGGACACCCGAAAGTCAATCCACTCAGGCTGAACGAGCTCCCATCGCCCCTTCTCAGGTC
TCTGCGTTGGCAGCTCAAGCAGCTGTCCCTGTTGATGTCTGTAGCTACTGTCAGAAACCGCGACACAACATTCGTCAGTGCCGTGCCCTGCAGAAGGACC
TACGCGATGGCTGTATCAAGGCAGGCACTGTCCTTCCCGCGAACTTTGAATTGCGTGGTCCCAATTCCTATCGATCTCACCCTTACAACAACAACAACAG
CAACCAAGGGCGATCTGGACGAGGCAGTGGATCATGGCATCAAGGCGGTCGTGGTGGTCGTGGTGGTGGTGGCCGTGGCCGAGGTAGTTATGGTGGGAAT
CACAACGGAAACGGCAACAACACCAACGGCAACAACAACAACAACAAGTCTTCACGTCGCGATGAAGGTGGCTATGACCAGTCACGCCGCAAGGAACTCT
GATTGCTGTTGTGTCGAATGTGCAGACAGCTGCATCCGCCATCAGCCTAACGGCTCAGCCCAGCCCGAAGCTTGACACCTGCTGGACAATTGATTCCGGC
TGTAGCAGCCATGTTACTCAACACGCGGAGTGGTTCAAGACGAAGACACTTGCAAGTGGGGGCATCACTGTGGGCGGAAAATCGCAGGTCCCGATCGAAG
CTATTGGTACGGTGGAGCTTCAGATCACCGACTCTAAGGGCCAAGCGCAGACCCTAACGCTGCATGATGTCCTGCTGGCTCCGAAACTCCAGTACAATCT
GCTCTCAGTTGCTGCCGCTGTTGACGATGACTTCCGTTTTGGTTTTAAGCGTACAATGTGTACTGTCCAAACCAACCACCGCTTCTCCATCAAGGCGATG
AAATCCGCGACGTCGAAGCTCTATCAGTTCGAGGCCACACCGGTTCCAAAGGCTGAAGCTCACGTGGCTACTTCAGGTAAGCCAACTCGCCTCATACTTT
TACACAAACGCCTTGGTCATCCTAACATCCGTGTTATGCAGGCACTCACTAAAGACCAAGCTCTTCACGGACTGGATGCACCAGCTGTAGTTAAGCCAGA
TTCTTTCTTTTGCGCTGCATGTACTTACCCGAAGTCACACCGCGCCCCTTTCCATCTAATAGACATGTTGAACGCTCTACAAGTCCGTTGCATAAAGTTC
ACTCTGACATTTGTGGCCCCCTTCCCGTCCCTAGCCTCGGCGGTTGTCGCTATTTTGCCGTGTTCATAGATGACTTTAGCCGCTACATGTTCACTTACCC
GATGAAGGCACGTAGTGAACTATACACGTGCTACCAAGACTTTCGTATGAAAGCACTGAATATCTTTCGCAGTGATGTCCATACACTTGAATATCTCTTG
CCACCGCCTGATGTGGAAATCCAGGCCTTGCAAGCCGACAATGCAAAAGAGTACGAAAAACTGGGACGTCTCGTTTTTTCGAAATATGGAACGCACGCTC
AATTTACCAATGCTTATACGCCACAACAGAATGGTGTTGCAGAACGACGCATGCGCACGATCATGGAACGTGTCCGCGCACTACTGCTAGACGCCTCGCT
ACCTAAACCACTTTGGGCAGAATGTGTTACACATGTTACGACACTCCTGAACATGACACCG