Description :
From Genome Similarity Track
Location :
Scaffold_3145:1- 2058
Transcript NameFunction/comments
Phypl_g15647putative polyprotein

Sequence
2056 bases(100 bases per row)
TCTTCGCCGAGTACAACTTCGTTGTGCATTACAAGCCCGGCAAGAACAATATCCTTGCTGACGCGCTGTCGCGCCGCCCAGATTATGATCCGAGATGAGA
TATTGGACATCAGGCTTCTGATgtcgatgacgaggacgacgaatGCGCTTGCTGTGTTGAGCTTGGCATCAACACGACGATCTCGGTGCCGATGCTGCCG
CTCCGCGAACAGATCGTTGAGTCATACGACAATGATTCGTTCTACGCCGACATCATCGCACACCTTCGAGATcccagcgcggcgtccttgaagaagttga
cAAGCCCAACTCGCGATCACATCAAGCGTTACCAGCTTGATGGCCCGCTTCTGACGTACACGATGGACACCTTCGACTCGCCGTGCGTCGTCATCCCAGC
CGATGACGACCTCCGTGCCCGCCTGGTCCATGAATACCATGACGCACCCGTCGGTCATCTCGGTTGCGAGAAGACGTTCGCTGCGCTATCCCGCGACTTT
TTCTGGCCTCGCATGTACAAGTGGATTCGAAAGTGGGTTCGATCCTGCGAGACTTGTCAACGCGTCAAGccctcgccttcgtcgcagGCTCCGCTGCATC
CGTTGCCGATTGCTACGGCCGCATGGCGTTCTGTCAGCATGGACTTCATCTTCGGGCTGCCTCCGGACTACCAGGGCCGCACGGGTGTCCTGGTTCTCGT
TGACCGCTTCAGCAAGATGGTCCATCTTGCTCCAGTCGCCACTCAAGTCACCGCAGAGGACATGGCCAGGCTTTTCCTCGATCTGATATTCCGGCACCAC
GGTCTGCCGGAATCCATCATGTCCGACCGCGACCCGCGCTTCATGTCAGCCTTCTGGGCTCGgctcttcgagctgcttggtACGCACTTGCTGATGTCGA
CGGCGGCCCATCCGGAAACGGATGGGCAAATGGAGCGCGTCaaccgcgtgctggaagacgtcCTTCGCAGCTACGCCACGTCGTTCTCCTCGTGGAGTTC
CTTCTTGCCGCTTGCCAGATTCGCCATCAACAATACTGTCCACGCGTCAACCGGGTTGACGCCGTTTTTCGTGAACAACGCGCGACACCCGCGCGTTCCG
GCGCTGCTCACCCTGGGGTCGATGATAGAGAGCACGGGATCCACTCTTGGTGGGGGAGGAACTGGAGAAGCGCCGAGCGTATCGGTTCTAGAGTCGAGTG
AAGCTGATACTGCATCGGGAGCCACACCAATACTAACGGCATCGCATCGAGGACCCGCTCGCAGAATGCGAGTCCCCGCAGTCCCACAcgacttcttctc
ctgcttcgcCCGACGCGACTGGTGCCGTCGCGTCTCCCGTCGCCAACTTCGCTCCCAAGGAAGCTGCTTCGCCGATCAGTTCAGCTGCTGTGTCCAACTT
CGTGCTCCATCGCCAAGCCGTCACACGCTTTGTACGTGACGCGCTGCAAGCAGCCGTGGATAAGCAGAAAGAGAATGCGGGCAAACGGGGTTGGAAGAAC
ACCGCTGTCTTCCGACGAGGCGATCGCGTCCTGTTATCAACTACAGGGATTCAAGCATCAGCAGTGACGAACTTGGGCGCCAACAAATCGGCGCCAAGAT
TTATTGGACCATTCAAAATTACGAAGGTGCACGGTGATGCCTACANCAGACGCTCCACGAGACTCCGCTGTTCGCGACGCGTCctctcggctgctgctgt
caccACGGTCGCGTCCTCGCGAGCACCCTCCGCCAACTCCTGCGTGTCGTACACGTGGTTCGACAtctgctccgcctccgcgCGCATCAAGCGATACTGG
TCCAGCGTCAGTCGCTTCGAGTGGCACTGCCCCTCGGGGCCGCGAGGCGCCTCGACAACCGCCGACGCAGGCGTCCTTTCGCCGCGACAGTCCACCCCCG
CTGTTTGACGCGTCGggcgctcggcgctggattGCCGTGCGCATTGTTGATCACGATACCCGTAAGCCGCGCGCGACTGGTACTGCGTCGGCGCCTCAAC
GGGCTCGTGCTGAAAAGCACTACCGTGTCCACTGGCTGGGATACTCGCCAGCGGAG