Description :
From Genome Similarity Track
Location :
scaffold_1876:1- 2052
Transcript NameFunction/comments
g11742.t1hypothetical protein

Sequence
2050 bases(100 bases per row)
TTCGTCGTATGGAAGCACAAACCAAGGCTTTCCTGATGAAGACGATGGATGACACTCACATCCGTCTTGTCAAGAACCTTACGACTGCCTTCGATATCTT
CCAGGCCATCTGTACCAAGTATGAGGGTGCTGCTTTTCATGGCGATCCTTACTTCATTCAGCATTTCCTTATGGAGATCAAGTACGAGGAAGGTGGTGAC
TTGACCAGCTTCTTCCTTGAGCTGGAAAACGCGATGAAAGCCGCGTCTGAAGCGACCGAGTCTCCCTTGACTGACGGACAAAAGTCTCTGTACCTGTTCC
ATTCGATGCCGAAGACTTGGAAGGATGACCTCCGAGTTTGGAAAGGCGTGCGGAAGTATATCCCGTATGATGAACTCAAGATGAGCATTGATACAAAGGT
TCGCGAAATCCAGGCTCAAGAACGTTACAGCCTTATCAAAGGGACACCCGAAAGTCATTCCACTCAGGCTGAACGGGCTCTCATCGCCCCTTCTCAGGAC
TCTGCGTTGGCAGCTCAAGCAGCTGTCCCTGTTGATGTCTGTAGCTACTGTCAGAAACCGCGACACAACATTCGTCAGTGCCGTGCCCTGCAGAAGGACC
TACGCGATGGCTGTGTCAAGGCAGGCACTGCCCTTCCCGCGAACTTTGAATTGCGTGGTCCCAATTCCTATCGATCTCACCCTTACAACAACAACAACAA
CAACAACAACCAAGGGCGATCTGGACGAGGCAGTGGATCATGGCATCAAGGCGGTCGTGGTGGTGGTGGTGGCCGTGGCCGAGGTAGTTATGGTGGGAAT
CACAACAACAACGGCAACAACAACAACAACAACAAGTCTTCACGTCGCGATGAAGGTGGCTATGACCAGTCACGCCGCAAGGAAACTCTGATTGCTGTTG
TGTCAAATGTGCAGACAGCTGCATCCGCCATCAGCCTAACGGCTCAGCCGAGCCCGAACCTTGACACCTGCTGGACAATTGATTCCGGCTGTAGCATCCA
TGTTACTCAACACGCGGAGTGGTTCAAGACGAAGACACTTGCAAGTGGGGGCATCACTGTGGGCGGGAAATCGCTGGTCCCGATCGAAGCTATTGGTACA
GTGGAGCTTCAGATCACCGACTCTAAGGGCCAAGCGCGGACCCTAATGCTGCATGATGTCCTGCTGGCTCCGAAACTCCAGTACAATATGCTCTCTGTTG
CTGCCGCTGTTGACGATGACTTCCGTTTTGGTTTTAAGCGTACAATGTGTACTGTCCAAACCAACCACCGCTTCTCCATCAAGGCGATGAAATCCGCGAC
GTCGAAGCTCTATCAGTTCGAGGCCACACCGGTTCCAAAGGCTGAAGCTCACGTGGCTACTTCAGGTAAGCCAACTCGTCTCATGCTTTTACACAAACGC
CTTGGTATCCTAACATCCGTGTTAGGCAGGCACTCACTAAAGACCAAGCTCTTCACGGACTGGATGCACCAGCTGTAGTTAAGCCAGATTCTTTCTTTTG
CGCTGCATGTACTTACGCGAAGTCACACCGCGCCCATTTTCCATCTAATAGACATGTTGAACGCTCTACAAGTCCGTTGCATAAAGTTCACTCTGACATT
TATGGCCCCTTTCCCGTCCCTAGCCTCGGCGGTTGTCGCTATTTTGTCGTGTTCATAGATGACTTTAGCCGCTACATGTTCACTTACCCGATGAAGGCAC
GCAGTGAACTATACACGTGCTACCAAGACTTTCGTATGAAAGCACTGAATATCTTTCGCAGTGATGTCCATACACTTGAATATCTCATGCCACCGCCTGA
TGTGGATATCCAGGCCTTGCAAGCCGACAATGCAAAAGAGTACGAAAAACTGGGACGTCTCGTTTTTTCGAAATATGGAACGCACGCTCAATTTACCAAT
GCTTATACACCACAACAGAATGTTGTTGCAGAACGACGCATGCGCACGATCATGGAACGTGTCCGCGCACTACTGCTAGACGCCTCGCTACCTAAACCAC
TTTGGGCAGAATGTGTTACACATGTTACGACACTCCTGAACATGACACCG